Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213938463:

Variant ID: vg1213938463 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13938463
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATACCAAATATAGATAGAATATCTTATTTGTGTCTCGGGTTTGTTTCTCAACTTGTACATCAAGGAAATACCTTGAGACTTAGTCGGCTACGACTGTAT[T/C]
TTATCTGTATCTGCCTATTCCGTTAGGGATATAGATTATCTTTTGTAACACGGACTCCTTCCCATATATAGGGGGGTCCGGGTGCCTCTAGGGGCAGAGG

Reverse complement sequence

CCTCTGCCCCTAGAGGCACCCGGACCCCCCTATATATGGGAAGGAGTCCGTGTTACAAAAGATAATCTATATCCCTAACGGAATAGGCAGATACAGATAA[A/G]
ATACAGTCGTAGCCGACTAAGTCTCAAGGTATTTCCTTGATGTACAAGTTGAGAAACAAACCCGAGACACAAATAAGATATTCTATCTATATTTGGTATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.60%	0.20%	31.29%	42.98%	NA
All Indica	2759	11.00%	0.20%	35.92%	52.92%	NA
All Japonica	1512	52.10%	0.00%	24.87%	23.08%	NA
Aus	269	26.40%	0.70%	21.19%	51.67%	NA
Indica I	595	13.90%	0.00%	27.23%	58.82%	NA
Indica II	465	14.40%	0.00%	31.40%	54.19%	NA
Indica III	913	6.40%	0.40%	42.17%	51.04%	NA
Indica Intermediate	786	12.10%	0.10%	37.91%	49.87%	NA
Temperate Japonica	767	80.10%	0.00%	5.74%	14.21%	NA
Tropical Japonica	504	20.00%	0.00%	51.39%	28.57%	NA
Japonica Intermediate	241	29.90%	0.00%	30.29%	39.83%	NA
VI/Aromatic	96	13.50%	0.00%	27.08%	59.38%	NA
Intermediate	90	37.80%	1.10%	32.22%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213938463	T -> C	LOC_Os12g24420.1	upstream_gene_variant ; 248.0bp to feature; MODIFIER	silent_mutation	Average:24.501; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1213938463	T -> C	LOC_Os12g24430.1	upstream_gene_variant ; 332.0bp to feature; MODIFIER	silent_mutation	Average:24.501; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1213938463	T -> C	LOC_Os12g24420-LOC_Os12g24430	intergenic_region ; MODIFIER	silent_mutation	Average:24.501; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1213938463	T -> DEL	N	N	silent_mutation	Average:24.501; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213938463	NA	3.98E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213938463	3.03E-06	3.03E-06	mr1256	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213938463	NA	1.00E-05	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213938463	NA	1.33E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213938463	NA	1.82E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213938463	NA	3.08E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251