Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200948719:

Variant ID: vg1200948719 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 948719
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GAATCATCATCGTTACTGGATAGTTCTGTTGTAACATCACTCAGTCGTCTTGCCATTGCTTCCTGCAGTAACACAACAATGTGATGATGGTAGGGAAGGG[C/T]
ATGTCCATGAGTCAAATTCAAAGATTACAAACTAGCTGCCATTGTATCTGGAAAGAAAATAAATAACAGTGTTTTCAATTCTCTCTTTCCTCAATAAACT

Reverse complement sequence

AGTTTATTGAGGAAAGAGAGAATTGAAAACACTGTTATTTATTTTCTTTCCAGATACAATGGCAGCTAGTTTGTAATCTTTGAATTTGACTCATGGACAT[G/A]
CCCTTCCCTACCATCATCACATTGTTGTGTTACTGCAGGAAGCAATGGCAAGACGACTGAGTGATGTTACAACAGAACTATCCAGTAACGATGATGATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	38.30%	0.06%	0.21%	NA
All Indica	2759	46.30%	53.30%	0.07%	0.29%	NA
All Japonica	1512	96.50%	3.40%	0.00%	0.07%	NA
Aus	269	3.00%	97.00%	0.00%	0.00%	NA
Indica I	595	75.50%	24.50%	0.00%	0.00%	NA
Indica II	465	11.80%	87.70%	0.00%	0.43%	NA
Indica III	913	49.00%	50.80%	0.00%	0.22%	NA
Indica Intermediate	786	41.60%	57.60%	0.25%	0.51%	NA
Temperate Japonica	767	95.20%	4.80%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.20%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	27.80%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200948719	C -> DEL	N	N	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg1200948719	C -> T	LOC_Os12g02700.1	upstream_gene_variant ; 3172.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg1200948719	C -> T	LOC_Os12g02690.1	downstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg1200948719	C -> T	LOC_Os12g02690.3	downstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg1200948719	C -> T	LOC_Os12g02690.2	downstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg1200948719	C -> T	LOC_Os12g02690.4	downstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg1200948719	C -> T	LOC_Os12g02710.1	intron_variant ; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200948719	NA	9.27E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	1.88E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	4.02E-08	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	1.04E-22	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	2.44E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	1.69E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	2.47E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	2.79E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	5.15E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	3.79E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	2.43E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	4.56E-09	mr1944	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	3.64E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200948719	NA	1.12E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251