Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121220731:

Variant ID: vg1121220731 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 21220731
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AAATGATTTAACAGTGTTAACTACTACCTCCACGGTTATAAAACTTTTTGCTATTGTCCATATTCATATATATGTTAATGAATCCAAACATATATGTGTG[C/T]
CTAAATTCATTAACATCTGTATGAATGTGGTCAATGCTAAAAAATCTTAAGATCTGAAACAGAGGAAGTATGAGATAAAAAGACGTGTATATCCTTTCAT

Reverse complement sequence

ATGAAAGGATATACACGTCTTTTTATCTCATACTTCCTCTGTTTCAGATCTTAAGATTTTTTAGCATTGACCACATTCATACAGATGTTAATGAATTTAG[G/A]
CACACATATATGTTTGGATTCATTAACATATATATGAATATGGACAATAGCAAAAAGTTTTATAACCGTGGAGGTAGTAGTTAACACTGTTAAATCATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	47.00%	0.32%	0.72%	NA
All Indica	2759	27.00%	72.50%	0.29%	0.29%	NA
All Japonica	1512	93.50%	6.00%	0.40%	0.07%	NA
Aus	269	56.50%	34.60%	0.37%	8.55%	NA
Indica I	595	23.90%	75.30%	0.84%	0.00%	NA
Indica II	465	7.50%	92.30%	0.22%	0.00%	NA
Indica III	913	41.90%	57.50%	0.00%	0.55%	NA
Indica Intermediate	786	23.40%	76.00%	0.25%	0.38%	NA
Temperate Japonica	767	95.60%	3.70%	0.78%	0.00%	NA
Tropical Japonica	504	89.50%	10.50%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.10%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	61.10%	37.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1121220731	C -> T	LOC_Os11g36090.1	upstream_gene_variant ; 4418.0bp to feature; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1121220731	C -> T	LOC_Os11g36100.1	upstream_gene_variant ; 4071.0bp to feature; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1121220731	C -> T	LOC_Os11g36090-LOC_Os11g36100	intergenic_region ; MODIFIER	silent_mutation	Average:55.481; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1121220731	C -> DEL	N	N	silent_mutation	Average:55.481; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1121220731	NA	4.19E-11	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	1.94E-07	1.94E-07	mr1260	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	1.39E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	1.47E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	9.02E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	1.44E-06	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	2.66E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	1.73E-06	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	4.44E-12	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	7.48E-19	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121220731	NA	5.43E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251