Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100024654:

Variant ID: vg1100024654 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 24654
Reference Allele: G	Alternative Allele: A,GT
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CAATCTGAGCGCCCAACTGCCTCCTCGATATCAATATGCTTGGCCCGATGTCGATTTGCATGCCTAGCGTCCTCTCATCACTGGTCTATGCTATGGCAAT[G/A,GT]
TTACAACAGTATGATAAAACCATGGTCGAAACTGTACGGGGATGCAAAGTGAACTGGTTTTAACAATTAAGGAAAGCTTCAGAACCATATATTGATGCCC

Reverse complement sequence

GGGCATCAATATATGGTTCTGAAGCTTTCCTTAATTGTTAAAACCAGTTCACTTTGCATCCCCGTACAGTTTCGACCATGGTTTTATCATACTGTTGTAA[C/T,AC]
ATTGCCATAGCATAGACCAGTGATGAGAGGACGCTAGGCATGCAAATCGACATCGGGCCAAGCATATTGATATCGAGGAGGCAGTTGGGCGCTCAGATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	13.60%	6.07%	16.36%	GT: 0.02%
All Indica	2759	46.90%	15.50%	10.26%	27.29%	NA
All Japonica	1512	97.80%	1.10%	0.07%	1.12%	NA
Aus	269	35.70%	63.90%	0.37%	0.00%	NA
Indica I	595	54.60%	13.40%	8.24%	23.70%	NA
Indica II	465	68.80%	3.90%	7.74%	19.57%	NA
Indica III	913	30.40%	21.20%	14.57%	33.73%	NA
Indica Intermediate	786	47.30%	17.30%	8.27%	27.10%	NA
Temperate Japonica	767	97.00%	1.00%	0.00%	1.96%	NA
Tropical Japonica	504	98.60%	1.00%	0.20%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	87.50%	11.50%	0.00%	1.04%	NA
Intermediate	90	77.80%	16.70%	2.22%	2.22%	GT: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100024654	G -> A	LOC_Os11g01050.1	downstream_gene_variant ; 2374.0bp to feature; MODIFIER	silent_mutation	Average:33.561; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg1100024654	G -> A	LOC_Os11g01060.1	downstream_gene_variant ; 4972.0bp to feature; MODIFIER	silent_mutation	Average:33.561; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg1100024654	G -> A	LOC_Os11g01040-LOC_Os11g01050	intergenic_region ; MODIFIER	silent_mutation	Average:33.561; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg1100024654	G -> GT	LOC_Os11g01050.1	downstream_gene_variant ; 2373.0bp to feature; MODIFIER	silent_mutation	Average:33.561; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg1100024654	G -> GT	LOC_Os11g01060.1	downstream_gene_variant ; 4971.0bp to feature; MODIFIER	silent_mutation	Average:33.561; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg1100024654	G -> GT	LOC_Os11g01040-LOC_Os11g01050	intergenic_region ; MODIFIER	silent_mutation	Average:33.561; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg1100024654	G -> DEL	N	N	silent_mutation	Average:33.561; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100024654	1.84E-06	1.84E-06	mr1770	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251