Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922435973:

Variant ID: vg0922435973 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22435973
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

ATCGTGTATGGGTCTTGTTGAACTCAAAATAATGGAGCTGTTTGTTCATCCGTTAAGGATTCCCTGTCCTCTTTTTTTAATGCCATCCAAATGTATTGTT[T/C]
TATACAATGCCTATGTTATATATTTTTGTTGTAATTTGTATAAGCTTGAACTTTCATGTTGTGTAGTAACATATGCCATAATGATCTATCTTGTCACTTA

Reverse complement sequence

TAAGTGACAAGATAGATCATTATGGCATATGTTACTACACAACATGAAAGTTCAAGCTTATACAAATTACAACAAAAATATATAACATAGGCATTGTATA[A/G]
AACAATACATTTGGATGGCATTAAAAAAAGAGGACAGGGAATCCTTAACGGATGAACAAACAGCTCCATTATTTTGAGTTCAACAAGACCCATACACGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.70%	38.60%	1.99%	18.77%	NA
All Indica	2759	4.00%	63.40%	2.03%	30.55%	NA
All Japonica	1512	99.50%	0.30%	0.07%	0.07%	NA
Aus	269	57.60%	17.50%	12.27%	12.64%	NA
Indica I	595	2.70%	66.90%	1.34%	29.08%	NA
Indica II	465	4.70%	73.80%	1.29%	20.22%	NA
Indica III	913	1.60%	59.10%	2.85%	36.36%	NA
Indica Intermediate	786	7.30%	59.70%	2.04%	31.04%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	66.70%	20.00%	3.33%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922435973	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922435973	T -> C	LOC_Os09g39080.1	upstream_gene_variant ; 2297.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922435973	T -> C	LOC_Os09g39090.1	downstream_gene_variant ; 2086.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0922435973	T -> C	LOC_Os09g39080-LOC_Os09g39090	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922435973	NA	2.26E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	NA	2.89E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	NA	3.82E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	NA	3.37E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	1.92E-09	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	3.39E-09	1.36E-08	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	NA	8.45E-27	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	NA	5.23E-37	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	NA	5.95E-32	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	2.09E-08	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922435973	3.74E-06	2.31E-06	mr1865_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251