Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922253697:

Variant ID: vg0922253697 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22253697
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.26, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTGTCAAAATTTTGAAATCGTACACAGTAAGATTCAGAAAGCTAACCAAATCAGGAGGAAATGAACTTAGCCCAAATCAATCAAGGGAAACCAAATAA[T/C]
GCACCAAATTCGAGATGAATAGCTATTGCGGCAAGGCTTTCACGCATCAATCTCAAGCTTATACTTAATTAGACGCATCGCACTATGATCATTTGAACAG

Reverse complement sequence

CTGTTCAAATGATCATAGTGCGATGCGTCTAATTAAGTATAAGCTTGAGATTGATGCGTGAAAGCCTTGCCGCAATAGCTATTCATCTCGAATTTGGTGC[A/G]
TTATTTGGTTTCCCTTGATTGATTTGGGCTAAGTTCATTTCCTCCTGATTTGGTTAGCTTTCTGAATCTTACTGTGTACGATTTCAAAATTTTGACAGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	41.90%	0.04%	0.02%	NA
All Indica	2759	95.00%	5.00%	0.04%	0.00%	NA
All Japonica	1512	0.70%	99.30%	0.07%	0.00%	NA
Aus	269	30.90%	69.10%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	88.60%	11.20%	0.22%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.60%	7.40%	0.00%	0.00%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	30.00%	68.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922253697	T -> DEL	N	N	silent_mutation	Average:66.858; most accessible tissue: Callus, score: 76.67	N	N	N	N
vg0922253697	T -> C	LOC_Os09g38720.1	upstream_gene_variant ; 2302.0bp to feature; MODIFIER	silent_mutation	Average:66.858; most accessible tissue: Callus, score: 76.67	N	N	N	N
vg0922253697	T -> C	LOC_Os09g38700.1	downstream_gene_variant ; 4395.0bp to feature; MODIFIER	silent_mutation	Average:66.858; most accessible tissue: Callus, score: 76.67	N	N	N	N
vg0922253697	T -> C	LOC_Os09g38710.1	intron_variant ; MODIFIER	silent_mutation	Average:66.858; most accessible tissue: Callus, score: 76.67	N	N	N	N
vg0922253697	T -> C	LOC_Os09g38710.2	intron_variant ; MODIFIER	silent_mutation	Average:66.858; most accessible tissue: Callus, score: 76.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922253697	NA	6.89E-13	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	NA	3.76E-39	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	NA	7.35E-08	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	8.15E-08	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	4.03E-07	NA	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	NA	2.13E-43	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	NA	8.17E-25	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	NA	1.92E-32	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	2.24E-11	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697	1.18E-11	2.61E-09	mr1865_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251