Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818761789:

Variant ID: vg0818761789 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18761789
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACACTTTGTTCCGGTTTCATATAAACTTCCCTATTGTCACTACAATTTATTATCACTTTCTAAAGTTGAGTACCTATTAATAAATGAAACTGCATATGTA[C/T]
GAATAAAATAAGTCTAATATATTATTAATACACTAAAAATATCCACTATACCTAAGTGTTTTTGTCTCACTTATTTCCAATTCCATATAAAAACATTCTA

Reverse complement sequence

TAGAATGTTTTTATATGGAATTGGAAATAAGTGAGACAAAAACACTTAGGTATAGTGGATATTTTTAGTGTATTAATAATATATTAGACTTATTTTATTC[G/A]
TACATATGCAGTTTCATTTATTAATAGGTACTCAACTTTAGAAAGTGATAATAAATTGTAGTGACAATAGGGAAGTTTATATGAAACCGGAACAAAGTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	3.40%	2.29%	14.05%	NA
All Indica	2759	79.70%	0.00%	1.67%	18.59%	NA
All Japonica	1512	76.10%	10.40%	3.70%	9.79%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.10%	0.00%	0.84%	4.03%	NA
Indica II	465	93.10%	0.20%	0.22%	6.45%	NA
Indica III	913	69.10%	0.00%	1.42%	29.46%	NA
Indica Intermediate	786	72.40%	0.00%	3.44%	24.17%	NA
Temperate Japonica	767	97.40%	0.90%	1.69%	0.00%	NA
Tropical Japonica	504	40.30%	25.00%	6.94%	27.78%	NA
Japonica Intermediate	241	83.40%	10.00%	3.32%	3.32%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	5.60%	5.56%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818761789	C -> T	LOC_Os08g30490.1	upstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:31.574; most accessible tissue: Zhenshan97 flower, score: 54.272	N	N	N	N
vg0818761789	C -> T	LOC_Os08g30480.1	downstream_gene_variant ; 1388.0bp to feature; MODIFIER	silent_mutation	Average:31.574; most accessible tissue: Zhenshan97 flower, score: 54.272	N	N	N	N
vg0818761789	C -> T	LOC_Os08g30480-LOC_Os08g30490	intergenic_region ; MODIFIER	silent_mutation	Average:31.574; most accessible tissue: Zhenshan97 flower, score: 54.272	N	N	N	N
vg0818761789	C -> DEL	N	N	silent_mutation	Average:31.574; most accessible tissue: Zhenshan97 flower, score: 54.272	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818761789	3.61E-06	3.61E-06	mr1680	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251