Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810747174:

Variant ID: vg0810747174 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10747174
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AATATTTGCACTCTATTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCTGGACGAGGGTTTACACACATGTAAGCGTTTGGAGTTTTGGATAGAAATT[C/T]
CGGGCCTGACAAGTTGGTATCAGAGCCTCCTTGACCCTACGTTATGACAAATGGTTAACTTTAGAAGCCCTCTAAAAATTATTTAAAAATTAGAACTTTT

Reverse complement sequence

AAAAGTTCTAATTTTTAAATAATTTTTAGAGGGCTTCTAAAGTTAACCATTTGTCATAACGTAGGGTCAAGGAGGCTCTGATACCAACTTGTCAGGCCCG[G/A]
AATTTCTATCCAAAACTCCAAACGCTTACATGTGTGTAAACCCTCGTCCAGGAATCAGCCGAGGCACACAATAACAAATTGATAATAGAGTGCAAATATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.60%	7.00%	1.95%	64.52%	NA
All Indica	2759	4.70%	11.70%	2.65%	80.94%	NA
All Japonica	1512	63.40%	0.10%	0.73%	35.85%	NA
Aus	269	48.30%	1.10%	0.74%	49.81%	NA
Indica I	595	4.20%	4.20%	6.05%	85.55%	NA
Indica II	465	4.70%	6.00%	2.37%	86.88%	NA
Indica III	913	2.50%	21.50%	0.99%	75.03%	NA
Indica Intermediate	786	7.80%	9.30%	2.16%	80.79%	NA
Temperate Japonica	767	92.80%	0.00%	0.00%	7.17%	NA
Tropical Japonica	504	31.20%	0.20%	1.98%	66.67%	NA
Japonica Intermediate	241	36.90%	0.00%	0.41%	62.66%	NA
VI/Aromatic	96	7.30%	0.00%	3.12%	89.58%	NA
Intermediate	90	33.30%	3.30%	3.33%	60.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810747174	C -> T	LOC_Os08g17560.1	upstream_gene_variant ; 2523.0bp to feature; MODIFIER	silent_mutation	Average:8.817; most accessible tissue: Callus, score: 27.423	N	N	N	N
vg0810747174	C -> T	LOC_Os08g17570.1	intron_variant ; MODIFIER	silent_mutation	Average:8.817; most accessible tissue: Callus, score: 27.423	N	N	N	N
vg0810747174	C -> DEL	N	N	silent_mutation	Average:8.817; most accessible tissue: Callus, score: 27.423	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810747174	NA	9.10E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810747174	NA	3.73E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810747174	1.42E-06	NA	mr1547	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810747174	NA	1.70E-06	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810747174	3.91E-06	3.91E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810747174	NA	1.54E-06	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810747174	NA	2.29E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251