Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810407609:

Variant ID: vg0810407609 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10407609
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTCTAATCTGTATGGTAGGATGGTATACACTTTAATGTGATCCGAGTGGCTTTTCATAAAGCAGAGATGTTGGCCTACAGAACATCTTAGAAGGAACA[T/C]
ACCTATATGAGTCCGACTGCTAGTCACAGTCTATGAGATCTTGGTGATCTCTAGATACTCATGAAAAGGCCAGGAGTATGACTTATATGCTCCAAACAGA

Reverse complement sequence

TCTGTTTGGAGCATATAAGTCATACTCCTGGCCTTTTCATGAGTATCTAGAGATCACCAAGATCTCATAGACTGTGACTAGCAGTCGGACTCATATAGGT[A/G]
TGTTCCTTCTAAGATGTTCTGTAGGCCAACATCTCTGCTTTATGAAAAGCCACTCGGATCACATTAAAGTGTATACCATCCTACCATACAGATTAGAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.90%	9.60%	7.22%	3.22%	NA
All Indica	2759	88.60%	6.70%	4.60%	0.11%	NA
All Japonica	1512	76.50%	4.20%	11.18%	8.13%	NA
Aus	269	19.30%	72.90%	7.81%	0.00%	NA
Indica I	595	95.00%	1.30%	3.70%	0.00%	NA
Indica II	465	84.90%	9.70%	5.38%	0.00%	NA
Indica III	913	88.40%	7.90%	3.50%	0.22%	NA
Indica Intermediate	786	86.10%	7.60%	6.11%	0.13%	NA
Temperate Japonica	767	91.80%	2.10%	5.61%	0.52%	NA
Tropical Japonica	504	54.60%	6.00%	21.23%	18.25%	NA
Japonica Intermediate	241	73.90%	7.10%	7.88%	11.20%	NA
VI/Aromatic	96	61.50%	4.20%	13.54%	20.83%	NA
Intermediate	90	73.30%	7.80%	12.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810407609	T -> C	LOC_Os08g17000.1	upstream_gene_variant ; 2484.0bp to feature; MODIFIER	silent_mutation	Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0810407609	T -> C	LOC_Os08g16990.1	downstream_gene_variant ; 318.0bp to feature; MODIFIER	silent_mutation	Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0810407609	T -> C	LOC_Os08g16990-LOC_Os08g17000	intergenic_region ; MODIFIER	silent_mutation	Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0810407609	T -> DEL	N	N	silent_mutation	Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810407609	1.58E-06	1.12E-07	mr1109_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810407609	NA	3.44E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810407609	3.95E-06	3.95E-06	mr1466_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810407609	NA	5.40E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251