Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623193044:

Variant ID: vg0623193044 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23193044
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

CGTTGATTTTCACTTAAATGGTGAACCCGATAATTTTAAACCATTAGATTAAACTTTCCGGTGGACCCGATATTTTAGGCCATTAGATTACATATATTTT[A/T]
AAAAAAGAAACTAATTCCTTAGGCAGTTACGTGTTTATGTATACAGGAGAAATTTGTACGTACGTACAACTGAACTAATGAAGAGAAAAAAAACTACACA

Reverse complement sequence

TGTGTAGTTTTTTTTCTCTTCATTAGTTCAGTTGTACGTACGTACAAATTTCTCCTGTATACATAAACACGTAACTGCCTAAGGAATTAGTTTCTTTTTT[T/A]
AAAATATATGTAATCTAATGGCCTAAAATATCGGGTCCACCGGAAAGTTTAATCTAATGGTTTAAAATTATCGGGTTCACCATTTAAGTGAAAATCAACG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	28.30%	0.80%	5.12%	NA
All Indica	2759	55.20%	43.50%	1.12%	0.18%	NA
All Japonica	1512	82.10%	2.20%	0.00%	15.67%	NA
Aus	269	65.40%	33.10%	1.49%	0.00%	NA
Indica I	595	17.80%	82.00%	0.17%	0.00%	NA
Indica II	465	90.50%	9.00%	0.22%	0.22%	NA
Indica III	913	52.90%	44.00%	2.63%	0.44%	NA
Indica Intermediate	786	65.30%	34.10%	0.64%	0.00%	NA
Temperate Japonica	767	73.70%	0.00%	0.00%	26.34%	NA
Tropical Japonica	504	93.50%	6.00%	0.00%	0.60%	NA
Japonica Intermediate	241	85.10%	1.70%	0.00%	13.28%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	13.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623193044	A -> T	LOC_Os06g39060.1	upstream_gene_variant ; 3977.0bp to feature; MODIFIER	silent_mutation	Average:31.547; most accessible tissue: Callus, score: 55.951	N	N	N	N
vg0623193044	A -> T	LOC_Os06g39070.1	upstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:31.547; most accessible tissue: Callus, score: 55.951	N	N	N	N
vg0623193044	A -> T	LOC_Os06g39060-LOC_Os06g39070	intergenic_region ; MODIFIER	silent_mutation	Average:31.547; most accessible tissue: Callus, score: 55.951	N	N	N	N
vg0623193044	A -> DEL	N	N	silent_mutation	Average:31.547; most accessible tissue: Callus, score: 55.951	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623193044	NA	2.50E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	NA	8.68E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	8.83E-07	8.82E-07	mr1466	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	NA	5.68E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	NA	2.41E-08	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	3.04E-06	NA	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	2.49E-06	3.19E-09	mr1659	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	NA	8.19E-08	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	NA	6.13E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623193044	NA	1.30E-10	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251