Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507443101:

Variant ID: vg0507443101 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7443101
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCCCTGAGTGAATGTGCCCTTGGAGAGCAATTTCTTGCATCATGAGATTCACCACGTCAAACTGACGACCCTGAATAATAGCATCAATGACGTGCCAA[G/A]
CCACCCCCCTAATATCATCATTGTTGCCACATCAAGGAAGGATTGTAGCTCTCACAATTCTGTTTACCACTGGGAATGGTCCTCAACCTTGCAATCTTCC

Reverse complement sequence

GGAAGATTGCAAGGTTGAGGACCATTCCCAGTGGTAAACAGAATTGTGAGAGCTACAATCCTTCCTTGATGTGGCAACAATGATGATATTAGGGGGGTGG[C/T]
TTGGCACGTCATTGATGCTATTATTCAGGGTCGTCAGTTTGACGTGGTGAATCTCATGATGCAAGAAATTGCTCTCCAAGGGCACATTCACTCAGGGATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.90%	1.40%	13.33%	23.36%	NA
All Indica	2759	40.80%	0.10%	20.48%	38.60%	NA
All Japonica	1512	92.40%	4.20%	3.04%	0.40%	NA
Aus	269	88.50%	0.00%	4.46%	7.06%	NA
Indica I	595	12.90%	0.00%	39.16%	47.90%	NA
Indica II	465	56.30%	0.40%	13.98%	29.25%	NA
Indica III	913	48.50%	0.00%	12.16%	39.32%	NA
Indica Intermediate	786	43.90%	0.00%	19.85%	36.26%	NA
Temperate Japonica	767	87.40%	6.50%	5.35%	0.78%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	92.90%	5.40%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	0.00%	7.78%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507443101	G -> DEL	N	N	silent_mutation	Average:56.353; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0507443101	G -> A	LOC_Os05g13410.1	upstream_gene_variant ; 1426.0bp to feature; MODIFIER	silent_mutation	Average:56.353; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0507443101	G -> A	LOC_Os05g13390.1	downstream_gene_variant ; 4798.0bp to feature; MODIFIER	silent_mutation	Average:56.353; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0507443101	G -> A	LOC_Os05g13420.1	downstream_gene_variant ; 3235.0bp to feature; MODIFIER	silent_mutation	Average:56.353; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0507443101	G -> A	LOC_Os05g13420.2	downstream_gene_variant ; 3235.0bp to feature; MODIFIER	silent_mutation	Average:56.353; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N
vg0507443101	G -> A	LOC_Os05g13400.1	intron_variant ; MODIFIER	silent_mutation	Average:56.353; most accessible tissue: Zhenshan97 young leaf, score: 77.422	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507443101	NA	1.79E-06	mr1897	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507443101	2.46E-06	2.46E-06	mr1024_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507443101	9.81E-09	9.81E-09	mr1317_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507443101	2.05E-06	1.44E-07	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507443101	5.48E-08	5.48E-08	mr1897_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507443101	9.14E-07	9.14E-07	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507443101	9.49E-07	9.49E-07	mr1927_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251