Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0428163509:

Variant ID: vg0428163509 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 28163509
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TCACAATGACAATAAACAGAAGAGGCAGTGGACGGGCCGTACAGGAGTATGATGACAGTGTTTGACGGGACTTCTAGAAATTATAAAAACGAAACCCAAC[A/G]
AGACAATAAACTCTACAAACTATACGATCCAATTTGTAAAGGTTCCAAGGAGAATGAATAGAAACGATGGTAGATCAAGCAAGCAAATAAAAAAAAGTAA

Reverse complement sequence

TTACTTTTTTTTATTTGCTTGCTTGATCTACCATCGTTTCTATTCATTCTCCTTGGAACCTTTACAAATTGGATCGTATAGTTTGTAGAGTTTATTGTCT[T/C]
GTTGGGTTTCGTTTTTATAATTTCTAGAAGTCCCGTCAAACACTGTCATCATACTCCTGTACGGCCCGTCCACTGCCTCTTCTGTTTATTGTCATTGTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	41.70%	0.32%	0.00%	NA
All Indica	2759	92.30%	7.20%	0.51%	0.00%	NA
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	NA
Aus	269	55.80%	44.20%	0.00%	0.00%	NA
Indica I	595	95.00%	3.90%	1.18%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	88.60%	11.00%	0.44%	0.00%	NA
Indica Intermediate	786	92.70%	6.90%	0.38%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	37.80%	61.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0428163509	A -> G	LOC_Os04g47470.1	upstream_gene_variant ; 3076.0bp to feature; MODIFIER	silent_mutation	Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0428163509	A -> G	LOC_Os04g47460.1	downstream_gene_variant ; 867.0bp to feature; MODIFIER	silent_mutation	Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0428163509	A -> G	LOC_Os04g47450-LOC_Os04g47460	intergenic_region ; MODIFIER	silent_mutation	Average:36.222; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0428163509	9.63E-10	1.93E-07	Awn_length	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0428163509	NA	6.30E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509	NA	5.03E-25	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509	NA	9.25E-42	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509	NA	7.20E-35	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509	NA	4.53E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509	NA	1.15E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0428163509	NA	8.51E-36	mr1878_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251