| Variant ID: vg0411099780 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11099780 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATACTCAAGGCGTAAGCATGATTGAAGCCGACTGGAGAGAACCTCTCATAAGATTTTTGACCAAACAAGAACTCCCTCAAGACAAAAATGAAGCCGAGC[A/T]
GATTTCCAGGCGCAGCAGACTCTATGTCATTCACGAGACCGAGTTGTACAAGAAAAGTCCATCAGGAATTCTGCAGCGCTGCGTATCTTTGGAAGAGGGA
TCCCTCTTCCAAAGATACGCAGCGCTGCAGAATTCCTGATGGACTTTTCTTGTACAACTCGGTCTCGTGAATGACATAGAGTCTGCTGCGCCTGGAAATC[T/A]
GCTCGGCTTCATTTTTGTCTTGAGGGAGTTCTTGTTTGGTCAAAAATCTTATGAGAGGTTCTCTCCAGTCGGCTTCAATCATGCTTACGCCTTGAGTATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.20% | 2.50% | 1.46% | 10.85% | NA |
| All Indica | 2759 | 99.40% | 0.00% | 0.07% | 0.51% | NA |
| All Japonica | 1512 | 62.10% | 4.20% | 2.71% | 30.95% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.00% | 0.22% | 1.29% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 99.10% | 0.10% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 96.30% | 0.40% | 1.17% | 2.09% | NA |
| Tropical Japonica | 504 | 6.00% | 9.50% | 5.36% | 79.17% | NA |
| Japonica Intermediate | 241 | 70.50% | 5.40% | 2.07% | 21.99% | NA |
| VI/Aromatic | 96 | 14.60% | 44.80% | 21.88% | 18.75% | NA |
| Intermediate | 90 | 70.00% | 10.00% | 5.56% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411099780 | A -> DEL | N | N | silent_mutation | Average:26.706; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0411099780 | A -> T | LOC_Os04g19910.1 | downstream_gene_variant ; 1487.0bp to feature; MODIFIER | silent_mutation | Average:26.706; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0411099780 | A -> T | LOC_Os04g19900.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.706; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411099780 | NA | 5.78E-06 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411099780 | NA | 1.68E-10 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411099780 | 4.80E-06 | 4.79E-06 | mr1664 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411099780 | NA | 5.28E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411099780 | NA | 1.96E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |