Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411097811:

Variant ID: vg0411097811 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 11097811
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GCAACAAGATCTCCGACATAACCGACGATGTCATCATCGCCGCCTTTACTAAAGGCATTCGCCACGAGGACCTAGTCGACAAGTTCGGACGCAAATCTCC[C/T]
AGGACAGGAAGGATATCTTTGCATGGAAACCATCCGATATGCCTGGTATTCCTAGAGAGGTGATTGAGCACTCTTTACATGTTAAGGAAGACGCCAAACC

Reverse complement sequence

GGTTTGGCGTCTTCCTTAACATGTAAAGAGTGCTCAATCACCTCTCTAGGAATACCAGGCATATCGGATGGTTTCCATGCAAAGATATCCTTCCTGTCCT[G/A]
GGAGATTTGCGTCCGAACTTGTCGACTAGGTCCTCGTGGCGAATGCCTTTAGTAAAGGCGGCGATGATGACATCGTCGGTTATGTCGGAGATCTTGTTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.20%	35.50%	0.57%	25.73%	NA
All Indica	2759	6.80%	49.00%	0.91%	43.35%	NA
All Japonica	1512	98.30%	0.90%	0.00%	0.86%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	4.20%	23.70%	1.68%	70.42%	NA
Indica II	465	23.90%	52.70%	0.43%	23.01%	NA
Indica III	913	1.30%	59.10%	0.66%	38.88%	NA
Indica Intermediate	786	5.00%	54.10%	0.89%	40.08%	NA
Temperate Japonica	767	97.90%	0.40%	0.00%	1.69%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	34.40%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411097811	C -> DEL	N	N	silent_mutation	Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0411097811	C -> T	LOC_Os04g19910.1	downstream_gene_variant ; 3456.0bp to feature; MODIFIER	silent_mutation	Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0411097811	C -> T	LOC_Os04g19900.1	intron_variant ; MODIFIER	silent_mutation	Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411097811	NA	4.97E-17	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	1.83E-07	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	6.73E-23	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	2.84E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	9.58E-24	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	9.84E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	8.76E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	1.31E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	1.39E-07	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	1.24E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	3.26E-06	2.34E-06	mr1638	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	3.04E-16	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	2.39E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	7.69E-06	3.27E-22	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	2.58E-10	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	4.32E-14	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	1.21E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	2.10E-32	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811	NA	1.79E-15	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251