Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408103883:

Variant ID: vg0408103883 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8103883
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGAGTTCAACGGGATTACTACACAATACATTAGAACCGATCAAGGCGTCGTGAGAGGAAACGTTCCGCTACCTCAAGTTGTAGTTTCACCAAAGGTAAC[T/C]
TCCGATTCGCCCAACCCATACTTTGCTATTCAAAAGGTTAGTGATCGTTGTGTAGATGCATATGCTACCTCTAGTTTTGCTCCTATACAGTATGCTTATA

Reverse complement sequence

TATAAGCATACTGTATAGGAGCAAAACTAGAGGTAGCATATGCATCTACACAACGATCACTAACCTTTTGAATAGCAAAGTATGGGTTGGGCGAATCGGA[A/G]
GTTACCTTTGGTGAAACTACAACTTGAGGTAGCGGAACGTTTCCTCTCACGACGCCTTGATCGGTTCTAATGTATTGTGTAGTAATCCCGTTGAACTCGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.30%	0.10%	0.42%	73.13%	NA
All Indica	2759	9.20%	0.20%	0.72%	89.92%	NA
All Japonica	1512	63.00%	0.00%	0.00%	37.04%	NA
Aus	269	2.20%	0.00%	0.00%	97.77%	NA
Indica I	595	7.10%	0.00%	1.18%	91.76%	NA
Indica II	465	25.60%	0.40%	1.51%	72.47%	NA
Indica III	913	3.60%	0.10%	0.11%	96.17%	NA
Indica Intermediate	786	7.50%	0.30%	0.64%	91.60%	NA
Temperate Japonica	767	96.00%	0.00%	0.00%	4.04%	NA
Tropical Japonica	504	8.10%	0.00%	0.00%	91.87%	NA
Japonica Intermediate	241	72.60%	0.00%	0.00%	27.39%	NA
VI/Aromatic	96	4.20%	0.00%	0.00%	95.83%	NA
Intermediate	90	33.30%	0.00%	0.00%	66.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408103883	T -> C	LOC_Os04g14470.1	upstream_gene_variant ; 4900.0bp to feature; MODIFIER	silent_mutation	Average:11.618; most accessible tissue: Minghui63 root, score: 21.615	N	N	N	N
vg0408103883	T -> C	LOC_Os04g14480.1	upstream_gene_variant ; 1779.0bp to feature; MODIFIER	silent_mutation	Average:11.618; most accessible tissue: Minghui63 root, score: 21.615	N	N	N	N
vg0408103883	T -> C	LOC_Os04g14490.1	intron_variant ; MODIFIER	silent_mutation	Average:11.618; most accessible tissue: Minghui63 root, score: 21.615	N	N	N	N
vg0408103883	T -> DEL	N	N	silent_mutation	Average:11.618; most accessible tissue: Minghui63 root, score: 21.615	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408103883	NA	3.73E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408103883	NA	1.21E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408103883	NA	1.24E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408103883	NA	7.80E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408103883	2.08E-06	2.08E-06	mr1664	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408103883	NA	8.09E-14	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251