Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400250392:

Variant ID: vg0400250392 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 250392
Reference Allele: A	Alternative Allele: T,AT,AAT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGCATGAAATTCACTGTTAAGCGGCGCCTGCGAAAATCAGACCACTTAAGCGACGCCTTATGTGGTCCGCCTGCAAAAATAGTACCTACCAAAAAAAA[A/T,AT,AAT]
CTAGTCATCTCATCCTTATCCTCTCCTCCCCACCACTCATTTCCCTCCCCCTCCTCTCTCTCTCTCTCTCCCCCACACTTAGAAAAATCGCCCGGCTCCC

Reverse complement sequence

GGGAGCCGGGCGATTTTTCTAAGTGTGGGGGAGAGAGAGAGAGAGAGGAGGGGGAGGGAAATGAGTGGTGGGGAGGAGAGGATAAGGATGAGATGACTAG[T/A,AT,ATT]
TTTTTTTTGGTAGGTACTATTTTTGCAGGCGGACCACATAAGGCGTCGCTTAAGTGGTCTGATTTTCGCAGGCGCCGCTTAACAGTGAATTTCATGCCGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	10.40%	6.14%	1.86%	AT: 2.26%; AAT: 0.15%
All Indica	2759	90.30%	0.40%	7.36%	1.49%	AT: 0.40%; AAT: 0.11%
All Japonica	1512	58.70%	31.20%	5.22%	2.78%	AT: 1.92%; AAT: 0.26%
Aus	269	99.30%	0.00%	0.37%	0.00%	AT: 0.37%
Indica I	595	83.20%	0.00%	15.46%	1.34%	NA
Indica II	465	88.00%	1.10%	8.39%	2.15%	AT: 0.43%
Indica III	913	95.30%	0.00%	2.74%	1.20%	AT: 0.44%; AAT: 0.33%
Indica Intermediate	786	91.20%	0.60%	5.98%	1.53%	AT: 0.64%
Temperate Japonica	767	36.40%	57.20%	3.52%	0.78%	AT: 2.09%
Tropical Japonica	504	86.50%	1.60%	6.15%	3.77%	AT: 1.19%; AAT: 0.79%
Japonica Intermediate	241	71.40%	10.00%	8.71%	7.05%	AT: 2.90%
VI/Aromatic	96	31.20%	0.00%	0.00%	2.08%	AT: 66.67%
Intermediate	90	76.70%	10.00%	7.78%	3.33%	AT: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400250392	A -> DEL	N	N	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AT	LOC_Os04g01320.1	upstream_gene_variant ; 1164.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AT	LOC_Os04g01330.1	upstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AT	LOC_Os04g01340.1	downstream_gene_variant ; 1605.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AT	LOC_Os04g01320-LOC_Os04g01330	intergenic_region ; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AAT	LOC_Os04g01320.1	upstream_gene_variant ; 1164.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AAT	LOC_Os04g01330.1	upstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AAT	LOC_Os04g01340.1	downstream_gene_variant ; 1605.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> AAT	LOC_Os04g01320-LOC_Os04g01330	intergenic_region ; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> T	LOC_Os04g01320.1	upstream_gene_variant ; 1163.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> T	LOC_Os04g01330.1	upstream_gene_variant ; 68.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> T	LOC_Os04g01340.1	downstream_gene_variant ; 1606.0bp to feature; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N
vg0400250392	A -> T	LOC_Os04g01320-LOC_Os04g01330	intergenic_region ; MODIFIER	silent_mutation	Average:65.858; most accessible tissue: Zhenshan97 young leaf, score: 85.542	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0400250392	A	AAT	-0.15	-0.03	-0.11	0.03	-0.05	-0.03
vg0400250392	A	AT	-0.22	-0.1	-0.18	-0.02	-0.15	-0.15
vg0400250392	A	T	-0.16	-0.06	-0.1	-0.04	-0.12	-0.13

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400250392	NA	2.20E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0400250392	NA	2.04E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	1.69E-06	1.69E-06	mr1464	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	2.14E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	2.98E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	6.63E-06	6.63E-06	mr1899	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	6.97E-09	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.64E-33	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	3.36E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	4.34E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	2.38E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	5.07E-10	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.40E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.05E-09	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.33E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	5.80E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	5.61E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.13E-09	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	6.94E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	2.59E-07	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	6.33E-07	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.05E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	2.10E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.21E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	1.79E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	2.93E-10	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	9.08E-09	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	4.20E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400250392	NA	3.08E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251