Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0400233241:

Variant ID: vg0400233241 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 233241
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCTTGTGTGTCACTCTACCCTTGATTTATCTTAACCCCTGCTTAGAATATGATTATTACAAGTAACATATAAATTATTAGTCAGGTTCTCTCTACTAT[A/G]
ATCTTTCCACGAGATTAAATAAATACGATACCATTGGAATACTCTCGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGATGAACTCTGTAACCA

Reverse complement sequence

TGGTTACAGAGTTCATCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCGAGAGTATTCCAATGGTATCGTATTTATTTAATCTCGTGGAAAGAT[T/C]
ATAGTAGAGAGAACCTGACTAATAATTTATATGTTACTTGTAATAATCATATTCTAAGCAGGGGTTAAGATAAATCAAGGGTAGAGTGACACACAAGCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	10.40%	0.02%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	68.70%	31.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	42.40%	57.60%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	90.50%	9.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0400233241	A -> G	LOC_Os04g01300.1	upstream_gene_variant ; 3200.0bp to feature; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg0400233241	A -> G	LOC_Os04g01300.4	upstream_gene_variant ; 4137.0bp to feature; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg0400233241	A -> G	LOC_Os04g01300.2	upstream_gene_variant ; 3203.0bp to feature; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg0400233241	A -> G	LOC_Os04g01300.3	upstream_gene_variant ; 3180.0bp to feature; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg0400233241	A -> G	LOC_Os04g01300-LOC_Os04g01310	intergenic_region ; MODIFIER	silent_mutation	Average:48.491; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0400233241	1.93E-06	1.93E-06	mr1464	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	6.68E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	6.86E-09	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	8.01E-06	8.00E-06	mr1899	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	8.05E-08	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	5.97E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	7.11E-09	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	3.52E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	1.59E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	7.11E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	2.95E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	6.13E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	5.66E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	3.80E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	7.56E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	3.42E-09	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0400233241	NA	2.11E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251