Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335838360:

Variant ID: vg0335838360 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35838360
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAAGATCACTGCTGGTTACATATATACACATCGTAAAAGCTAGTTTATGACCTGATATCATTGTTGTTAAATGTCAAGGTAAGTCGCTTTGTATTTT[G/T]
TTGTGAAATATGTGGATGCATATATGTTAAATATTGTGGAAATGATAGATGGTATATGTTAAAATATTATGGTAAAGATATGGAAAATGATTATTTGTGT

Reverse complement sequence

ACACAAATAATCATTTTCCATATCTTTACCATAATATTTTAACATATACCATCTATCATTTCCACAATATTTAACATATATGCATCCACATATTTCACAA[C/A]
AAAATACAAAGCGACTTACCTTGACATTTAACAACAATGATATCAGGTCATAAACTAGCTTTTACGATGTGTATATATGTAACCAGCAGTGATCTTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.60%	0.15%	0.06%	NA
All Indica	2759	50.20%	49.50%	0.14%	0.11%	NA
All Japonica	1512	53.20%	46.80%	0.00%	0.00%	NA
Aus	269	67.70%	32.00%	0.37%	0.00%	NA
Indica I	595	27.90%	71.80%	0.17%	0.17%	NA
Indica II	465	61.90%	37.80%	0.00%	0.22%	NA
Indica III	913	56.20%	43.70%	0.11%	0.00%	NA
Indica Intermediate	786	53.20%	46.40%	0.25%	0.13%	NA
Temperate Japonica	767	20.50%	79.50%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	70.50%	29.50%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335838360	G -> T	LOC_Os03g63430.1	upstream_gene_variant ; 352.0bp to feature; MODIFIER	silent_mutation	Average:69.266; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0335838360	G -> T	LOC_Os03g63440.1	upstream_gene_variant ; 2261.0bp to feature; MODIFIER	silent_mutation	Average:69.266; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0335838360	G -> T	LOC_Os03g63430.2	upstream_gene_variant ; 352.0bp to feature; MODIFIER	silent_mutation	Average:69.266; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0335838360	G -> T	LOC_Os03g63430-LOC_Os03g63440	intergenic_region ; MODIFIER	silent_mutation	Average:69.266; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N
vg0335838360	G -> DEL	N	N	silent_mutation	Average:69.266; most accessible tissue: Minghui63 flower, score: 78.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335838360	NA	8.90E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	NA	8.43E-08	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	NA	9.12E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	8.86E-07	NA	mr1616	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	NA	9.77E-07	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	NA	7.31E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	NA	2.43E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	NA	7.60E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335838360	NA	1.49E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251