Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319690518:

Variant ID: vg0319690518 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19690518
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.10, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTGGTATTCTTGTGCACTTGCATACTTGCTGTGTGGCTTGCGGAGTATTCCATGTACTCACCTTGCAATAATCAATCAAACCTCAGTTGAAGAGAAGT[C/T]
GCAAAGGAGAAGACGTTTGGCTTATACCCTAGTTGAGCTGCCTGTGGGAGTGGAGCCGGAGCTTCGCTAGACCGTAATTCCGCTGCTATTTTCTCTTTTC

Reverse complement sequence

GAAAAGAGAAAATAGCAGCGGAATTACGGTCTAGCGAAGCTCCGGCTCCACTCCCACAGGCAGCTCAACTAGGGTATAAGCCAAACGTCTTCTCCTTTGC[G/A]
ACTTCTCTTCAACTGAGGTTTGATTGATTATTGCAAGGTGAGTACATGGAATACTCCGCAAGCCACACAGCAAGTATGCAAGTGCACAAGAATACCAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	1.80%	1.61%	0.00%	NA
All Indica	2759	94.50%	2.80%	2.75%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.60%	1.80%	2.52%	0.00%	NA
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	92.30%	4.20%	3.50%	0.00%	NA
Indica Intermediate	786	93.40%	3.20%	3.44%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319690518	C -> T	LOC_Os03g35520.1	downstream_gene_variant ; 3527.0bp to feature; MODIFIER	silent_mutation	Average:53.083; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0319690518	C -> T	LOC_Os03g35540.1	downstream_gene_variant ; 475.0bp to feature; MODIFIER	silent_mutation	Average:53.083; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0319690518	C -> T	LOC_Os03g35520-LOC_Os03g35540	intergenic_region ; MODIFIER	silent_mutation	Average:53.083; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319690518	NA	5.05E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319690518	NA	1.19E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319690518	NA	2.39E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319690518	NA	9.30E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319690518	NA	3.00E-06	mr1043_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319690518	4.96E-06	4.96E-06	mr1919_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251