Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142120136:

Variant ID: vg0142120136 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42120136
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.27, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAAAAAGGAGGTATAGTACATACCGACCCCACCAAAAACCAAAAGTATAAAAGTTTTACTTAGGCCTAGTTTAGTTCCTAACTTTTTCTTTAAACTTA[T/C]
AACTTTTTCATCACATTAAAACTTTTCTACACACATAAAATTTTAACTTTTTTCTTTAAACTTTCAATTTTGACGTGAAATTAAACACAGCTTATTGCCT

Reverse complement sequence

AGGCAATAAGCTGTGTTTAATTTCACGTCAAAATTGAAAGTTTAAAGAAAAAAGTTAAAATTTTATGTGTGTAGAAAAGTTTTAATGTGATGAAAAAGTT[A/G]
TAAGTTTAAAGAAAAAGTTAGGAACTAAACTAGGCCTAAGTAAAACTTTTATACTTTTGGTTTTTGGTGGGGTCGGTATGTACTATACCTCCTTTTTCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.70% 0.08% 0.00% NA
All Indica  2759 42.40% 57.50% 0.07% 0.00% NA
All Japonica  1512 92.90% 7.10% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 65.40% 34.60% 0.00% 0.00% NA
Indica II  465 17.40% 82.60% 0.00% 0.00% NA
Indica III  913 32.70% 67.30% 0.00% 0.00% NA
Indica Intermediate  786 51.00% 48.70% 0.25% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 18.50% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 65.60% 32.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142120136 T -> C LOC_Os01g72600.1 downstream_gene_variant ; 2381.0bp to feature; MODIFIER silent_mutation Average:80.561; most accessible tissue: Zhenshan97 panicle, score: 95.143 N N N N
vg0142120136 T -> C LOC_Os01g72590-LOC_Os01g72600 intergenic_region ; MODIFIER silent_mutation Average:80.561; most accessible tissue: Zhenshan97 panicle, score: 95.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142120136 T C 0.03 0.01 0.0 0.0 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142120136 NA 2.67E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142120136 NA 1.10E-06 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142120136 8.77E-06 1.36E-10 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142120136 NA 1.18E-09 mr1974_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251