Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140885275:

Variant ID: vg0140885275 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40885275
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTTTCCATAGATCCTGAGCGAATTGCATGTATTTTGTAGGTGATTTGAGAAGGGCTTTGCTGCTGTGATTGGTTGTTCTTGGTTTACTTCACCCTGTT[G/A]
CTTCGGTGGACTTTCTGGTGATCTGATCTGGTATAATAGATCTGGCAAAAGAGAGGCATTTGCTGTCGCTAGCATTTTGCAGAAACTTATTTTCCTTTTT

Reverse complement sequence

AAAAAGGAAAATAAGTTTCTGCAAAATGCTAGCGACAGCAAATGCCTCTCTTTTGCCAGATCTATTATACCAGATCAGATCACCAGAAAGTCCACCGAAG[C/T]
AACAGGGTGAAGTAAACCAAGAACAACCAATCACAGCAGCAAAGCCCTTCTCAAATCACCTACAAAATACATGCAATTCGCTCAGGATCTATGGAAACCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	43.50%	0.08%	0.00%	NA
All Indica	2759	93.30%	6.60%	0.11%	0.00%	NA
All Japonica	1512	2.60%	97.40%	0.00%	0.00%	NA
Aus	269	5.60%	94.40%	0.00%	0.00%	NA
Indica I	595	91.90%	7.90%	0.17%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	96.10%	3.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.20%	11.60%	0.25%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	4.40%	95.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140885275	G -> A	LOC_Os01g70600.1	downstream_gene_variant ; 4094.0bp to feature; MODIFIER	silent_mutation	Average:36.41; most accessible tissue: Callus, score: 48.193	N	N	N	N
vg0140885275	G -> A	LOC_Os01g70610.1	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:36.41; most accessible tissue: Callus, score: 48.193	N	N	N	N
vg0140885275	G -> A	LOC_Os01g70620.1	downstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:36.41; most accessible tissue: Callus, score: 48.193	N	N	N	N
vg0140885275	G -> A	LOC_Os01g70630.1	intron_variant ; MODIFIER	silent_mutation	Average:36.41; most accessible tissue: Callus, score: 48.193	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140885275	NA	1.05E-30	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	1.28E-48	mr1798	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	1.00E-16	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	4.39E-16	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	5.38E-50	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	1.28E-44	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	6.30E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	5.47E-06	5.65E-09	mr1563_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	6.90E-30	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	4.78E-40	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140885275	NA	1.15E-30	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251