\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216595642:

Variant ID: vg1216595642 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16595642
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.21, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GTACAGTACTACAGTTCACTATCTATTGACTTGTTGGCCGCGTGATGCAGATCAGCAGACGGACGGACGGACTACAGGCCCGTCACCCGCACACCATTCA[T/C]
CCGAAGCCCGGCCACGACGCCGGCGTTGGGGCCGATCCATCCCCGACCACCGTCCGCCTTCGGCCCGGAGACCGACGTACGGATCGGAGGCACCGGTGCG

Reverse complement sequence

CGCACCGGTGCCTCCGATCCGTACGTCGGTCTCCGGGCCGAAGGCGGACGGTGGTCGGGGATGGATCGGCCCCAACGCCGGCGTCGTGGCCGGGCTTCGG[A/G]
TGAATGGTGTGCGGGTGACGGGCCTGTAGTCCGTCCGTCCGTCTGCTGATCTGCATCACGCGGCCAACAAGTCAATAGATAGTGAACTGTAGTACTGTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 23.00% 0.78% 14.85% NA
All Indica  2759 57.70% 16.70% 1.27% 24.32% NA
All Japonica  1512 72.30% 26.50% 0.07% 1.12% NA
Aus  269 40.10% 59.10% 0.00% 0.74% NA
Indica I  595 76.10% 8.20% 0.50% 15.13% NA
Indica II  465 66.50% 29.90% 0.22% 3.44% NA
Indica III  913 35.30% 16.60% 2.30% 45.78% NA
Indica Intermediate  786 64.60% 15.40% 1.27% 18.70% NA
Temperate Japonica  767 97.00% 2.60% 0.00% 0.39% NA
Tropical Japonica  504 30.40% 68.80% 0.20% 0.60% NA
Japonica Intermediate  241 81.30% 14.10% 0.00% 4.56% NA
VI/Aromatic  96 61.50% 35.40% 0.00% 3.12% NA
Intermediate  90 53.30% 35.60% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216595642 T -> C LOC_Os12g28100.1 5_prime_UTR_variant ; 710.0bp to feature; MODIFIER silent_mutation Average:93.452; most accessible tissue: Minghui63 root, score: 99.707 N N N N
vg1216595642 T -> C LOC_Os12g28110.1 upstream_gene_variant ; 1683.0bp to feature; MODIFIER silent_mutation Average:93.452; most accessible tissue: Minghui63 root, score: 99.707 N N N N
vg1216595642 T -> DEL N N silent_mutation Average:93.452; most accessible tissue: Minghui63 root, score: 99.707 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216595642 T C 0.01 0.01 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216595642 NA 5.18E-13 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1216595642 NA 2.72E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 7.64E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 6.23E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 6.99E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 8.13E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 3.47E-06 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 4.08E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 5.51E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 3.15E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 6.51E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 7.47E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 4.53E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 2.70E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 1.13E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 5.67E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 9.77E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 1.84E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 2.24E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 7.01E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 1.88E-10 mr1696_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 3.71E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 1.79E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216595642 NA 4.29E-11 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251