Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215780845:

Variant ID: vg1215780845 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15780845
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACATCTTACTTTTATAGATATTGTTGATCAATGTAGCATCTCGAAGACATTGTCGAAGTCCAACAATGCTTATATTTTGGGACGGAGAGAGTATTACT[T/C]
AAAATTTTAAATTAGAGAAAATCCATAAAATGCCATCGTACAAGTCTTTTTCTTCCAGAAATGCCATCGCCATCAACGCACCATTGATTCCACACCATTA

Reverse complement sequence

TAATGGTGTGGAATCAATGGTGCGTTGATGGCGATGGCATTTCTGGAAGAAAAAGACTTGTACGATGGCATTTTATGGATTTTCTCTAATTTAAAATTTT[A/G]
AGTAATACTCTCTCCGTCCCAAAATATAAGCATTGTTGGACTTCGACAATGTCTTCGAGATGCTACATTGATCAACAATATCTATAAAAGTAAGATGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.30%	5.10%	0.04%	0.61%	NA
All Indica	2759	95.20%	3.80%	0.04%	1.01%	NA
All Japonica	1512	91.70%	8.30%	0.07%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	92.40%	7.60%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.00%	0.22%	NA
Indica III	913	94.70%	3.50%	0.11%	1.64%	NA
Indica Intermediate	786	96.10%	2.40%	0.00%	1.53%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	76.40%	23.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215780845	T -> C	LOC_Os12g26940.1	downstream_gene_variant ; 921.0bp to feature; MODIFIER	silent_mutation	Average:34.083; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1215780845	T -> C	LOC_Os12g26950.1	downstream_gene_variant ; 132.0bp to feature; MODIFIER	silent_mutation	Average:34.083; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1215780845	T -> C	LOC_Os12g26940-LOC_Os12g26950	intergenic_region ; MODIFIER	silent_mutation	Average:34.083; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg1215780845	T -> DEL	N	N	silent_mutation	Average:34.083; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215780845	1.63E-06	NA	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	6.12E-08	NA	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	5.19E-07	NA	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	3.49E-06	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	3.04E-06	NA	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	7.19E-06	NA	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.28E-07	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	9.36E-09	NA	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	3.05E-06	NA	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	4.48E-06	NA	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	NA	1.46E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	9.51E-06	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.50E-06	NA	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	NA	1.10E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	7.57E-06	NA	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	4.28E-06	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	4.05E-07	NA	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	3.76E-06	NA	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	8.40E-07	NA	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	7.65E-06	NA	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	NA	1.09E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	4.88E-06	NA	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.74E-07	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	6.67E-07	NA	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	6.03E-08	NA	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	3.94E-11	NA	mr1055_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	5.66E-10	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	4.72E-07	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	4.64E-07	NA	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	3.93E-11	NA	mr1132_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	5.46E-10	NA	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	3.14E-08	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.31E-06	NA	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	NA	3.02E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.66E-09	NA	mr1390_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.86E-09	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	NA	8.27E-06	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	6.11E-07	2.32E-13	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.28E-07	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.26E-06	NA	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	1.82E-07	NA	mr1490_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215780845	8.47E-10	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251