\
| Variant ID: vg1208048440 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8048440 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )
AATATGGATGCTACATATCTGCTGACGAGGCGAATGCAGATAGAACACACAGGCAACCAAAACCCTTCCTATCCAAGATTTCTAGACTTATCTCTAACGT[A/T]
ATCATCAGCAAACTCCTAGATTTCTAGAAATGTTGTATTTGAACGAAATGTTCTGTTTACCAATTTGTCTTGGTCGGTACCGTGCAGGCAGTAACCTGAC
GTCAGGTTACTGCCTGCACGGTACCGACCAAGACAAATTGGTAAACAGAACATTTCGTTCAAATACAACATTTCTAGAAATCTAGGAGTTTGCTGATGAT[T/A]
ACGTTAGAGATAAGTCTAGAAATCTTGGATAGGAAGGGTTTTGGTTGCCTGTGTGTTCTATCTGCATTCGCCTCGTCAGCAGATATGTAGCATCCATATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.70% | 7.00% | 4.80% | 11.43% | NA |
| All Indica | 2759 | 86.90% | 0.80% | 5.18% | 7.10% | NA |
| All Japonica | 1512 | 53.00% | 19.90% | 5.22% | 21.83% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 85.90% | 0.70% | 2.86% | 10.59% | NA |
| Indica II | 465 | 93.30% | 0.60% | 1.72% | 4.30% | NA |
| Indica III | 913 | 85.10% | 0.90% | 8.11% | 5.91% | NA |
| Indica Intermediate | 786 | 86.00% | 0.90% | 5.60% | 7.51% | NA |
| Temperate Japonica | 767 | 78.20% | 2.60% | 1.43% | 17.73% | NA |
| Tropical Japonica | 504 | 23.20% | 48.40% | 11.51% | 16.87% | NA |
| Japonica Intermediate | 241 | 35.30% | 15.40% | 4.15% | 45.23% | NA |
| VI/Aromatic | 96 | 93.80% | 1.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 78.90% | 6.70% | 3.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208048440 | A -> DEL | N | N | silent_mutation | Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1208048440 | A -> T | LOC_Os12g14170.1 | upstream_gene_variant ; 391.0bp to feature; MODIFIER | silent_mutation | Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1208048440 | A -> T | LOC_Os12g14180.1 | downstream_gene_variant ; 2365.0bp to feature; MODIFIER | silent_mutation | Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1208048440 | A -> T | LOC_Os12g14170-LOC_Os12g14180 | intergenic_region ; MODIFIER | silent_mutation | Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208048440 | 8.29E-06 | NA | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | NA | 7.91E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | NA | 7.54E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | NA | 1.29E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | NA | 4.24E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | 4.76E-06 | NA | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | NA | 7.85E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | NA | 6.63E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | 8.64E-06 | 8.64E-06 | mr1436 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | 9.59E-08 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208048440 | 8.26E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |