\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208048440:

Variant ID: vg1208048440 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8048440
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AATATGGATGCTACATATCTGCTGACGAGGCGAATGCAGATAGAACACACAGGCAACCAAAACCCTTCCTATCCAAGATTTCTAGACTTATCTCTAACGT[A/T]
ATCATCAGCAAACTCCTAGATTTCTAGAAATGTTGTATTTGAACGAAATGTTCTGTTTACCAATTTGTCTTGGTCGGTACCGTGCAGGCAGTAACCTGAC

Reverse complement sequence

GTCAGGTTACTGCCTGCACGGTACCGACCAAGACAAATTGGTAAACAGAACATTTCGTTCAAATACAACATTTCTAGAAATCTAGGAGTTTGCTGATGAT[T/A]
ACGTTAGAGATAAGTCTAGAAATCTTGGATAGGAAGGGTTTTGGTTGCCTGTGTGTTCTATCTGCATTCGCCTCGTCAGCAGATATGTAGCATCCATATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 7.00% 4.80% 11.43% NA
All Indica  2759 86.90% 0.80% 5.18% 7.10% NA
All Japonica  1512 53.00% 19.90% 5.22% 21.83% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 85.90% 0.70% 2.86% 10.59% NA
Indica II  465 93.30% 0.60% 1.72% 4.30% NA
Indica III  913 85.10% 0.90% 8.11% 5.91% NA
Indica Intermediate  786 86.00% 0.90% 5.60% 7.51% NA
Temperate Japonica  767 78.20% 2.60% 1.43% 17.73% NA
Tropical Japonica  504 23.20% 48.40% 11.51% 16.87% NA
Japonica Intermediate  241 35.30% 15.40% 4.15% 45.23% NA
VI/Aromatic  96 93.80% 1.00% 1.04% 4.17% NA
Intermediate  90 78.90% 6.70% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208048440 A -> DEL N N silent_mutation Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1208048440 A -> T LOC_Os12g14170.1 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1208048440 A -> T LOC_Os12g14180.1 downstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1208048440 A -> T LOC_Os12g14170-LOC_Os12g14180 intergenic_region ; MODIFIER silent_mutation Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208048440 8.29E-06 NA mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 NA 7.91E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 NA 7.54E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 NA 1.29E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 NA 4.24E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 4.76E-06 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 NA 7.85E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 NA 6.63E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 8.64E-06 8.64E-06 mr1436 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 9.59E-08 NA mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440 8.26E-06 NA mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251