\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203449282:

Variant ID: vg1203449282 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3449282
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAACCTAATTAATCCATCATTAGCACATGTGGGTTACTGTAGTACTTATGGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCACGATTTTCC[C/A]
CCTAACTGTGCAATTAGTTTTTTATTTTATCTATATTTAATGCTACATGCATGTATCCAAAATTTTAATGTAGCGTTTTTTTAAAAAAAATAGGGACTAA

Reverse complement sequence

TTAGTCCCTATTTTTTTTAAAAAAACGCTACATTAAAATTTTGGATACATGCATGTAGCATTAAATATAGATAAAATAAAAAACTAATTGCACAGTTAGG[G/T]
GGAAAATCGTGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATAAGTACTACAGTAACCCACATGTGCTAATGATGGATTAATTAGGTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 4.50% 0.91% 0.00% NA
All Indica  2759 99.80% 0.10% 0.11% 0.00% NA
All Japonica  1512 83.50% 14.00% 2.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 72.10% 23.20% 4.69% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 86.70% 12.90% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203449282 C -> A LOC_Os12g07050.1 downstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1203449282 C -> A LOC_Os12g07050.3 downstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1203449282 C -> A LOC_Os12g07050.2 downstream_gene_variant ; 3547.0bp to feature; MODIFIER silent_mutation Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1203449282 C -> A LOC_Os12g07030-LOC_Os12g07050 intergenic_region ; MODIFIER silent_mutation Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203449282 NA 1.12E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 NA 4.63E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 NA 2.63E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 8.27E-06 NA mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 NA 6.04E-07 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 NA 6.67E-07 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 4.58E-06 4.58E-06 mr1474_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 1.90E-06 NA mr1748_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 NA 7.23E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282 NA 4.52E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251