Search for Variation information by Variation ID:
Detailed information for vg1203326244:
| Variant ID: vg1203326244 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 3326244 |
| Reference Allele: CTTGAAT | Alternative Allele: C,ATTGAAT |
| Primary Allele: CTTGAAT | Secondary Allele: ATTGAAT |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CTGCAGGATAATCACCGGTGCTTTCCAGGGAGGCCGCCTCCGCCCTTGCGGATGAAGGCGTTTCTATTTTTCGGCTTTGGTATGTCGTGGATATCCATCA[CTTGAAT/C,ATTGAAT]
TGTCCTCTGCTTTTTTGCTGCAAAAATAAGATGAGGAAAAAAATGTTAGATACATGGAAACCAGTCTATTACTTTAATATGCCATTTTTATGAAATTAAT
Reverse complement sequence
ATTAATTTCATAAAAATGGCATATTAAAGTAATAGACTGGTTTCCATGTATCTAACATTTTTTTCCTCATCTTATTTTTGCAGCAAAAAAGCAGAGGACA[ATTCAAG/G,ATTCAAT]
TGATGGATATCCACGACATACCAAAGCCGAAAAATAGAAACGCCTTCATCCGCAAGGGCGGAGGCGGCCTCCCTGGAAAGCACCGGTGATTATCCTGCAG
Allele Frequencies:
| Populations | Population Size | Frequency of CTTGAAT(primary allele) | Frequency of ATTGAAT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 1.80% | 1.04% | 0.42% | NA |
| All Indica | 2759 | 98.60% | 0.00% | 0.65% | 0.72% | NA |
| All Japonica | 1512 | 92.70% | 5.30% | 1.98% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 0.00% | 0.50% | 1.34% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.86% | 0.22% | NA |
| Indica III | 913 | 98.50% | 0.10% | 0.55% | 0.88% | NA |
| Indica Intermediate | 786 | 98.90% | 0.00% | 0.76% | 0.38% | NA |
| Temperate Japonica | 767 | 96.10% | 2.00% | 1.96% | 0.00% | NA |
| Tropical Japonica | 504 | 86.30% | 11.10% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203326244 | CTTGAAT -> C | LOC_Os12g06850.1 | inframe_deletion ; p.Ile310_Gln311del; MODERATE | N | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg1203326244 | CTTGAAT -> C | LOC_Os12g06850.3 | inframe_deletion ; p.Ile199_Gln200del; MODERATE | N | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg1203326244 | CTTGAAT -> C | LOC_Os12g06850.2 | 3_prime_UTR_variant ; 100.0bp to feature; MODIFIER | N | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg1203326244 | CTTGAAT -> C | LOC_Os12g06840.1 | upstream_gene_variant ; 1524.0bp to feature; MODIFIER | N | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg1203326244 | CTTGAAT -> C | LOC_Os12g06830.1 | downstream_gene_variant ; 4186.0bp to feature; MODIFIER | N | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg1203326244 | CTTGAAT -> C | LOC_Os12g06850.4 | downstream_gene_variant ; 570.0bp to feature; MODIFIER | N | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg1203326244 | CTTGAAT -> ATTGAAT | LOC_Os12g06850.1 | missense_variant ; p.Val312Leu; MODERATE | nonsynonymous_codon ; V312L | Average:67.552; most accessible tissue: Callus, score: 79.609 | benign  |
+0.900 |
N | N |
| vg1203326244 | CTTGAAT -> ATTGAAT | LOC_Os12g06850.3 | missense_variant ; p.Val201Leu; MODERATE | nonsynonymous_codon ; V201L | Average:67.552; most accessible tissue: Callus, score: 79.609 | benign |
+0.900 |
N | N |
| vg1203326244 | CTTGAAT -> DEL | LOC_Os12g06850.3 | N | frameshift_variant | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg1203326244 | CTTGAAT -> DEL | LOC_Os12g06850.1 | N | frameshift_variant | Average:67.552; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203326244 | NA | 1.73E-12 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 4.02E-12 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 2.52E-11 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 9.21E-11 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 8.88E-15 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 5.65E-12 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 1.20E-13 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 7.70E-14 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 8.61E-12 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 2.13E-09 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 3.27E-15 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | 4.51E-07 | 1.50E-17 | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 6.75E-15 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 7.10E-09 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | 4.15E-06 | 8.92E-17 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | 3.36E-06 | 1.16E-17 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203326244 | NA | 1.04E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |