\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203326244:

Variant ID: vg1203326244 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 3326244
Reference Allele: CTTGAATAlternative Allele: C,ATTGAAT
Primary Allele: CTTGAATSecondary Allele: ATTGAAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCAGGATAATCACCGGTGCTTTCCAGGGAGGCCGCCTCCGCCCTTGCGGATGAAGGCGTTTCTATTTTTCGGCTTTGGTATGTCGTGGATATCCATCA[CTTGAAT/C,ATTGAAT]
TGTCCTCTGCTTTTTTGCTGCAAAAATAAGATGAGGAAAAAAATGTTAGATACATGGAAACCAGTCTATTACTTTAATATGCCATTTTTATGAAATTAAT

Reverse complement sequence

ATTAATTTCATAAAAATGGCATATTAAAGTAATAGACTGGTTTCCATGTATCTAACATTTTTTTCCTCATCTTATTTTTGCAGCAAAAAAGCAGAGGACA[ATTCAAG/G,ATTCAAT]
TGATGGATATCCACGACATACCAAAGCCGAAAAATAGAAACGCCTTCATCCGCAAGGGCGGAGGCGGCCTCCCTGGAAAGCACCGGTGATTATCCTGCAG

Allele Frequencies:

Populations Population SizeFrequency of CTTGAAT(primary allele) Frequency of ATTGAAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 1.80% 1.04% 0.42% NA
All Indica  2759 98.60% 0.00% 0.65% 0.72% NA
All Japonica  1512 92.70% 5.30% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 0.00% 0.50% 1.34% NA
Indica II  465 98.90% 0.00% 0.86% 0.22% NA
Indica III  913 98.50% 0.10% 0.55% 0.88% NA
Indica Intermediate  786 98.90% 0.00% 0.76% 0.38% NA
Temperate Japonica  767 96.10% 2.00% 1.96% 0.00% NA
Tropical Japonica  504 86.30% 11.10% 2.58% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203326244 CTTGAAT -> C LOC_Os12g06850.1 inframe_deletion ; p.Ile310_Gln311del; MODERATE N Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N
vg1203326244 CTTGAAT -> C LOC_Os12g06850.3 inframe_deletion ; p.Ile199_Gln200del; MODERATE N Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N
vg1203326244 CTTGAAT -> C LOC_Os12g06850.2 3_prime_UTR_variant ; 100.0bp to feature; MODIFIER N Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N
vg1203326244 CTTGAAT -> C LOC_Os12g06840.1 upstream_gene_variant ; 1524.0bp to feature; MODIFIER N Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N
vg1203326244 CTTGAAT -> C LOC_Os12g06830.1 downstream_gene_variant ; 4186.0bp to feature; MODIFIER N Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N
vg1203326244 CTTGAAT -> C LOC_Os12g06850.4 downstream_gene_variant ; 570.0bp to feature; MODIFIER N Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N
vg1203326244 CTTGAAT -> ATTGAAT LOC_Os12g06850.1 missense_variant ; p.Val312Leu; MODERATE nonsynonymous_codon ; V312L Average:67.552; most accessible tissue: Callus, score: 79.609 benign +0.900 N N
vg1203326244 CTTGAAT -> ATTGAAT LOC_Os12g06850.3 missense_variant ; p.Val201Leu; MODERATE nonsynonymous_codon ; V201L Average:67.552; most accessible tissue: Callus, score: 79.609 benign +0.900 N N
vg1203326244 CTTGAAT -> DEL LOC_Os12g06850.3 N frameshift_variant Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N
vg1203326244 CTTGAAT -> DEL LOC_Os12g06850.1 N frameshift_variant Average:67.552; most accessible tissue: Callus, score: 79.609 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203326244 NA 1.73E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 4.02E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 2.52E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 9.21E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 8.88E-15 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 5.65E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 1.20E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 7.70E-14 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 8.61E-12 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 2.13E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 3.27E-15 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 4.51E-07 1.50E-17 mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 6.75E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 7.10E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 4.15E-06 8.92E-17 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 3.36E-06 1.16E-17 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203326244 NA 1.04E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251