\
| Variant ID: vg1104309736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4309736 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 109. )
GTGATTATAGAATACCACGTGGTGATTTAGGAGCGTTTGTAGAAGGCCATATGGTGGCTTGAGAGTATTTATTGGAAGTTTAATTAACTTTTATTATATA[T/A]
GTCCCTTAAACTTTTTAGAAAAAATAGCTGTCACGTGACACTCATATAAAAGCTTGTAGGTCACCACATGTCATATCTCTCAATTAAAAGAATTATTAAA
TTTAATAATTCTTTTAATTGAGAGATATGACATGTGGTGACCTACAAGCTTTTATATGAGTGTCACGTGACAGCTATTTTTTCTAAAAAGTTTAAGGGAC[A/T]
TATATAATAAAAGTTAATTAAACTTCCAATAAATACTCTCAAGCCACCATATGGCCTTCTACAAACGCTCCTAAATCACCACGTGGTATTCTATAATCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 40.60% | 7.02% | 4.40% | NA |
| All Indica | 2759 | 22.70% | 60.70% | 10.66% | 6.02% | NA |
| All Japonica | 1512 | 89.50% | 7.20% | 1.26% | 2.05% | NA |
| Aus | 269 | 58.70% | 37.90% | 2.97% | 0.37% | NA |
| Indica I | 595 | 22.90% | 68.10% | 7.73% | 1.34% | NA |
| Indica II | 465 | 13.30% | 58.70% | 11.40% | 16.56% | NA |
| Indica III | 913 | 27.50% | 57.40% | 11.72% | 3.40% | NA |
| Indica Intermediate | 786 | 22.40% | 60.10% | 11.20% | 6.36% | NA |
| Temperate Japonica | 767 | 98.80% | 0.70% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 73.80% | 18.30% | 3.17% | 4.76% | NA |
| Japonica Intermediate | 241 | 92.50% | 5.00% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 89.60% | 8.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 30.00% | 10.00% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104309736 | T -> A | LOC_Os11g08210-LOC_Os11g08220 | intergenic_region ; MODIFIER | silent_mutation | Average:15.956; most accessible tissue: Callus, score: 30.97 | N | N | N | N |
| vg1104309736 | T -> DEL | N | N | silent_mutation | Average:15.956; most accessible tissue: Callus, score: 30.97 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104309736 | NA | 1.86E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | 5.06E-13 | 7.18E-46 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | 4.14E-09 | 3.14E-11 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | NA | 2.27E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | NA | 9.37E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | NA | 5.20E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | NA | 3.77E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | NA | 2.13E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | 5.50E-07 | 1.58E-08 | mr1121_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | 4.42E-06 | 6.24E-06 | mr1200_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | 2.51E-06 | 2.51E-06 | mr1234_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104309736 | NA | 7.35E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |