\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1022578749:

Variant ID: vg1022578749 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 22578749
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.10, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTAACTAATCACAATCATTTTCTATTTTGATTTCATCATCTACTATCTTTTCTCAATTAATCATAATATATCTTTAAGTATTTTGGTCTACTTTTT[A/T]
AATATCTGTGTCCATCTAAAAATGGTTGGTTAGGGACGGAGAAAGTAAAGGATACAACAGCAAATTGCACTCCCCAGCACTGCAGGCGCTATAAGTTGTG

Reverse complement sequence

CACAACTTATAGCGCCTGCAGTGCTGGGGAGTGCAATTTGCTGTTGTATCCTTTACTTTCTCCGTCCCTAACCAACCATTTTTAGATGGACACAGATATT[T/A]
AAAAAGTAGACCAAAATACTTAAAGATATATTATGATTAATTGAGAAAAGATAGTAGATGATGAAATCAAAATAGAAAATGATTGTGATTAGTTAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.70% 17.70% 0.32% 48.31% NA
All Indica  2759 17.40% 2.80% 0.54% 79.23% NA
All Japonica  1512 57.50% 41.90% 0.00% 0.53% NA
Aus  269 71.40% 7.10% 0.00% 21.56% NA
Indica I  595 3.70% 4.00% 0.34% 91.93% NA
Indica II  465 26.20% 2.60% 0.86% 70.32% NA
Indica III  913 19.20% 1.00% 0.44% 79.41% NA
Indica Intermediate  786 20.60% 4.10% 0.64% 74.68% NA
Temperate Japonica  767 51.20% 48.10% 0.00% 0.65% NA
Tropical Japonica  504 58.70% 40.70% 0.00% 0.60% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 78.10% 0.00% 2.08% NA
Intermediate  90 33.30% 34.40% 0.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1022578749 A -> T LOC_Os10g41999.1 upstream_gene_variant ; 153.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022578749 A -> T LOC_Os10g41980.1 downstream_gene_variant ; 2218.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022578749 A -> T LOC_Os10g41980-LOC_Os10g41999 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1022578749 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1022578749 NA 7.00E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 7.99E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 6.20E-07 2.37E-08 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 3.61E-07 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 8.23E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 1.27E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 4.93E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 1.94E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 5.07E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 2.20E-06 5.48E-11 mr1748_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 9.75E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 5.30E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 5.30E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1022578749 NA 1.01E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251