\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014864085:

Variant ID: vg1014864085 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14864085
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, G: 0.08, A: 0.01, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TACAATGAATCTGGACAGAGAGCAAATTCAGATTTATTATATTAGGAAGTGTCCCATCCGTCTAAAATCTGGAGATTTTGATGTCCCATCCGTCTAAAAT[G/C]
TCTTAGGACGGAGTATTAGATTGTACTCACTACTGGATTGTTTTTATTTTGGTATGAAGTACAGCCTACAGGCGAGGGTGTGTTTGGTTGCATGCATGAA

Reverse complement sequence

TTCATGCATGCAACCAAACACACCCTCGCCTGTAGGCTGTACTTCATACCAAAATAAAAACAATCCAGTAGTGAGTACAATCTAATACTCCGTCCTAAGA[C/G]
ATTTTAGACGGATGGGACATCAAAATCTCCAGATTTTAGACGGATGGGACACTTCCTAATATAATAAATCTGAATTTGCTCTCTGTCCAGATTCATTGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 8.70% 1.16% 24.33% NA
All Indica  2759 57.20% 0.70% 1.45% 40.74% NA
All Japonica  1512 79.50% 19.50% 0.53% 0.46% NA
Aus  269 97.40% 0.00% 0.00% 2.60% NA
Indica I  595 50.40% 0.20% 3.36% 46.05% NA
Indica II  465 75.50% 0.60% 0.43% 23.44% NA
Indica III  913 51.90% 0.20% 1.64% 46.22% NA
Indica Intermediate  786 57.50% 1.50% 0.38% 40.59% NA
Temperate Japonica  767 95.20% 4.20% 0.52% 0.13% NA
Tropical Japonica  504 56.70% 41.50% 0.79% 0.99% NA
Japonica Intermediate  241 77.20% 22.40% 0.00% 0.41% NA
VI/Aromatic  96 15.60% 82.30% 2.08% 0.00% NA
Intermediate  90 60.00% 21.10% 5.56% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014864085 G -> C LOC_Os10g28550.1 downstream_gene_variant ; 1475.0bp to feature; MODIFIER silent_mutation Average:79.881; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg1014864085 G -> C LOC_Os10g28560.1 downstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:79.881; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg1014864085 G -> C LOC_Os10g28550-LOC_Os10g28560 intergenic_region ; MODIFIER silent_mutation Average:79.881; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg1014864085 G -> DEL N N silent_mutation Average:79.881; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1014864085 G C -0.01 -0.05 -0.02 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014864085 NA 4.33E-06 mr1045 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 1.49E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 5.22E-14 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 8.73E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 2.53E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 7.85E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 6.15E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 2.47E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 5.74E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 1.61E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 3.23E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 5.00E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 1.95E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 8.86E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 6.17E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 2.45E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 4.66E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 4.66E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 3.12E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 8.65E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014864085 NA 9.90E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251