\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003625739:

Variant ID: vg1003625739 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3625739
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GAGATCTCCCGGCGAGTTGGCTCCGTATACTCTGGCTTTGTAAACTTTGGTGGGTGTGTTGACGATTAGATTCGATGCCCTTCGCCTCTCCCTAGGGGTT[T/C]
CTTTTATACCATGGAATATCTTGACCCCTAAGTAAGACTTAGGTATATGCAAATTGGCACGATATAACCAGAGATTTTATCCCCTCCGAGTAGGAGTCCG

Reverse complement sequence

CGGACTCCTACTCGGAGGGGATAAAATCTCTGGTTATATCGTGCCAATTTGCATATACCTAAGTCTTACTTAGGGGTCAAGATATTCCATGGTATAAAAG[A/G]
AACCCCTAGGGAGAGGCGAAGGGCATCGAATCTAATCGTCAACACACCCACCAAAGTTTACAAAGCCAGAGTATACGGAGCCAACTCGCCGGGAGATCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.70% 18.00% 0.36% 53.98% NA
All Indica  2759 43.60% 1.00% 0.36% 55.02% NA
All Japonica  1512 1.00% 52.60% 0.26% 46.10% NA
Aus  269 10.80% 0.70% 0.00% 88.48% NA
Indica I  595 35.10% 2.40% 0.00% 62.52% NA
Indica II  465 38.50% 0.40% 0.65% 60.43% NA
Indica III  913 54.90% 0.30% 0.44% 44.36% NA
Indica Intermediate  786 39.90% 1.10% 0.38% 58.52% NA
Temperate Japonica  767 0.30% 86.80% 0.26% 12.65% NA
Tropical Japonica  504 1.40% 6.70% 0.40% 91.47% NA
Japonica Intermediate  241 2.50% 39.80% 0.00% 57.68% NA
VI/Aromatic  96 35.40% 9.40% 2.08% 53.12% NA
Intermediate  90 28.90% 17.80% 1.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003625739 T -> C LOC_Os10g06950.1 upstream_gene_variant ; 4136.0bp to feature; MODIFIER silent_mutation Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1003625739 T -> C LOC_Os10g06960.1 upstream_gene_variant ; 2205.0bp to feature; MODIFIER silent_mutation Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1003625739 T -> C LOC_Os10g06970.1 downstream_gene_variant ; 3659.0bp to feature; MODIFIER silent_mutation Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1003625739 T -> C LOC_Os10g06950-LOC_Os10g06960 intergenic_region ; MODIFIER silent_mutation Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1003625739 T -> DEL N N silent_mutation Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003625739 NA 5.97E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 1.83E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 1.14E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 2.45E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 6.50E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 9.81E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 5.80E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 2.46E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 4.19E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 1.44E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 1.74E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 4.68E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 9.41E-08 mr1736 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 9.64E-18 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 4.91E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 2.12E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739 NA 5.52E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251