Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003625739:

Variant ID: vg1003625739 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3625739
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GAGATCTCCCGGCGAGTTGGCTCCGTATACTCTGGCTTTGTAAACTTTGGTGGGTGTGTTGACGATTAGATTCGATGCCCTTCGCCTCTCCCTAGGGGTT[T/C]
CTTTTATACCATGGAATATCTTGACCCCTAAGTAAGACTTAGGTATATGCAAATTGGCACGATATAACCAGAGATTTTATCCCCTCCGAGTAGGAGTCCG

Reverse complement sequence

CGGACTCCTACTCGGAGGGGATAAAATCTCTGGTTATATCGTGCCAATTTGCATATACCTAAGTCTTACTTAGGGGTCAAGATATTCCATGGTATAAAAG[A/G]
AACCCCTAGGGAGAGGCGAAGGGCATCGAATCTAATCGTCAACACACCCACCAAAGTTTACAAAGCCAGAGTATACGGAGCCAACTCGCCGGGAGATCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.70%	18.00%	0.36%	53.98%	NA
All Indica	2759	43.60%	1.00%	0.36%	55.02%	NA
All Japonica	1512	1.00%	52.60%	0.26%	46.10%	NA
Aus	269	10.80%	0.70%	0.00%	88.48%	NA
Indica I	595	35.10%	2.40%	0.00%	62.52%	NA
Indica II	465	38.50%	0.40%	0.65%	60.43%	NA
Indica III	913	54.90%	0.30%	0.44%	44.36%	NA
Indica Intermediate	786	39.90%	1.10%	0.38%	58.52%	NA
Temperate Japonica	767	0.30%	86.80%	0.26%	12.65%	NA
Tropical Japonica	504	1.40%	6.70%	0.40%	91.47%	NA
Japonica Intermediate	241	2.50%	39.80%	0.00%	57.68%	NA
VI/Aromatic	96	35.40%	9.40%	2.08%	53.12%	NA
Intermediate	90	28.90%	17.80%	1.11%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003625739	T -> C	LOC_Os10g06950.1	upstream_gene_variant ; 4136.0bp to feature; MODIFIER	silent_mutation	Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg1003625739	T -> C	LOC_Os10g06960.1	upstream_gene_variant ; 2205.0bp to feature; MODIFIER	silent_mutation	Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg1003625739	T -> C	LOC_Os10g06970.1	downstream_gene_variant ; 3659.0bp to feature; MODIFIER	silent_mutation	Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg1003625739	T -> C	LOC_Os10g06950-LOC_Os10g06960	intergenic_region ; MODIFIER	silent_mutation	Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg1003625739	T -> DEL	N	N	silent_mutation	Average:50.885; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003625739	NA	5.97E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	1.83E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	1.14E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	2.45E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	6.50E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	9.81E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	5.80E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	2.46E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	4.19E-11	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	1.44E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	1.74E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	4.68E-08	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	9.41E-08	mr1736	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	9.64E-18	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	4.91E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	2.12E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625739	NA	5.52E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251