\
| Variant ID: vg1001593604 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1593604 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCGGTTGACCAGATTTACCGTGATTAGTCCCACCTTAATAAATTGACTCAATGCACTGTAGTTCAGGTGGGTTGGTTGGGCCTGTTCAACGTGGTGTAG[C/T]
GTTGATCAGTGGAGATTTAATGTTACTTTAATTACTCAACAGTTTAACCGTTTTGCTCAATAAAATGTTTTACAACCGCCTTTATGCAAATAGCCACAAA
TTTGTGGCTATTTGCATAAAGGCGGTTGTAAAACATTTTATTGAGCAAAACGGTTAAACTGTTGAGTAATTAAAGTAACATTAAATCTCCACTGATCAAC[G/A]
CTACACCACGTTGAACAGGCCCAACCAACCCACCTGAACTACAGTGCATTGAGTCAATTTATTAAGGTGGGACTAATCACGGTAAATCTGGTCAACCGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.30% | 16.90% | 6.43% | 5.33% | NA |
| All Indica | 2759 | 84.00% | 2.10% | 7.65% | 6.31% | NA |
| All Japonica | 1512 | 55.00% | 41.60% | 0.93% | 2.51% | NA |
| Aus | 269 | 60.20% | 0.40% | 27.14% | 12.27% | NA |
| Indica I | 595 | 90.90% | 0.20% | 7.73% | 1.18% | NA |
| Indica II | 465 | 87.70% | 2.60% | 5.81% | 3.87% | NA |
| Indica III | 913 | 79.30% | 1.90% | 8.11% | 10.73% | NA |
| Indica Intermediate | 786 | 81.90% | 3.40% | 8.14% | 6.49% | NA |
| Temperate Japonica | 767 | 78.70% | 20.70% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 21.40% | 69.60% | 1.59% | 7.34% | NA |
| Japonica Intermediate | 241 | 49.40% | 49.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 87.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 33.30% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001593604 | C -> T | LOC_Os10g03640.1 | upstream_gene_variant ; 3107.0bp to feature; MODIFIER | silent_mutation | Average:27.902; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg1001593604 | C -> T | LOC_Os10g03640-LOC_Os10g03660 | intergenic_region ; MODIFIER | silent_mutation | Average:27.902; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg1001593604 | C -> DEL | N | N | silent_mutation | Average:27.902; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001593604 | NA | 4.25E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 3.41E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 2.70E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 1.92E-08 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 2.14E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 1.26E-08 | mr1236 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 2.64E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 7.29E-09 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 1.05E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 2.40E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 5.10E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001593604 | NA | 7.80E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |