\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921889942:

Variant ID: vg0921889942 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21889942
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGCTGTCAATTTAACACTTATGCAAGAGATCGGCCGTCCAACAACACTACTGAAATTCAAGCTAAAGGAGGAGCATGCATTTAGTAGAGCTTTTAGCC[C/T]
GCCTAGAAAATCACCGTAAGCAAAGGATTGTTGTCCGAGGAAAAAAGCCTGGTAGGCGGAGCGAGCCGAGTAACGCTGGTCGCTTATCAAACGCTAAACC

Reverse complement sequence

GGTTTAGCGTTTGATAAGCGACCAGCGTTACTCGGCTCGCTCCGCCTACCAGGCTTTTTTCCTCGGACAACAATCCTTTGCTTACGGTGATTTTCTAGGC[G/A]
GGCTAAAAGCTCTACTAAATGCATGCTCCTCCTTTAGCTTGAATTTCAGTAGTGTTGTTGGACGGCCGATCTCTTGCATAAGTGTTAAATTGACAGCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 13.40% 2.20% 4.34% NA
All Indica  2759 94.60% 0.40% 1.30% 3.66% NA
All Japonica  1512 58.10% 38.50% 3.37% 0.00% NA
Aus  269 58.00% 0.40% 4.46% 37.17% NA
Indica I  595 91.10% 0.00% 0.17% 8.74% NA
Indica II  465 90.10% 0.40% 3.44% 6.02% NA
Indica III  913 98.90% 0.10% 0.11% 0.88% NA
Indica Intermediate  786 94.90% 1.10% 2.29% 1.65% NA
Temperate Japonica  767 90.10% 6.40% 3.52% 0.00% NA
Tropical Japonica  504 11.50% 85.70% 2.78% 0.00% NA
Japonica Intermediate  241 53.90% 41.90% 4.15% 0.00% NA
VI/Aromatic  96 78.10% 19.80% 1.04% 1.04% NA
Intermediate  90 72.20% 20.00% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921889942 C -> DEL N N silent_mutation Average:78.691; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0921889942 C -> T LOC_Os09g37958.1 upstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:78.691; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0921889942 C -> T LOC_Os09g37967.1 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:78.691; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0921889942 C -> T LOC_Os09g37958-LOC_Os09g37967 intergenic_region ; MODIFIER silent_mutation Average:78.691; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921889942 C T 0.0 -0.01 0.0 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921889942 NA 2.64E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921889942 NA 6.62E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921889942 8.54E-08 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921889942 2.29E-06 NA mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921889942 9.94E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921889942 NA 5.38E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921889942 NA 2.07E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251