\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900589112:

Variant ID: vg0900589112 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 589112
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.35, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGAAGATCGCCAGTCGGAGCGCCGCTACCCGTTGCCCGTACGCCGTCGTAAAGCCCAGCCATGATTCTTTCTCTTCATCAAGCCGAGGTCGTCGTGCC[A/G]
TTCGTCCGCGACGCTCACGTAACCATCACGCGGGAGCGCCCATAAACCATCGTCAAAGCCGGGGTCGTCGTGCCGTCCATCTGTGGCGTCTCCTTTTCTC

Reverse complement sequence

GAGAAAAGGAGACGCCACAGATGGACGGCACGACGACCCCGGCTTTGACGATGGTTTATGGGCGCTCCCGCGTGATGGTTACGTGAGCGTCGCGGACGAA[T/C]
GGCACGACGACCTCGGCTTGATGAAGAGAAAGAATCATGGCTGGGCTTTACGACGGCGTACGGGCAACGGGTAGCGGCGCTCCGACTGGCGATCTTCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 29.30% 0.04% 4.89% NA
All Indica  2759 97.50% 2.50% 0.00% 0.04% NA
All Japonica  1512 1.30% 83.40% 0.13% 15.15% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.10% 4.70% 0.00% 0.17% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 72.10% 0.26% 26.47% NA
Tropical Japonica  504 1.00% 98.80% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 87.10% 0.00% 10.37% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900589112 A -> G LOC_Os09g01850.1 upstream_gene_variant ; 1536.0bp to feature; MODIFIER silent_mutation Average:66.396; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0900589112 A -> G LOC_Os09g01860.1 downstream_gene_variant ; 3740.0bp to feature; MODIFIER silent_mutation Average:66.396; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0900589112 A -> G LOC_Os09g01850-LOC_Os09g01860 intergenic_region ; MODIFIER silent_mutation Average:66.396; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0900589112 A -> DEL N N silent_mutation Average:66.396; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900589112 NA 3.34E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 3.80E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 7.37E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 2.49E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 1.55E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 6.61E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 1.24E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 7.10E-07 NA mr1019_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 7.54E-06 NA mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 3.33E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 1.78E-31 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 7.49E-21 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 6.15E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 1.38E-21 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 7.71E-06 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 6.30E-51 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 2.03E-08 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 8.74E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 1.52E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 1.14E-08 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 7.99E-20 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 8.31E-33 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 3.17E-08 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 4.24E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900589112 NA 3.46E-24 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251