\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718587094:

Variant ID: vg0718587094 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18587094
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TATCCTCTTACTGACTTTCTCGAATTTAATGTGTGATTCTCTATTCTTCCACATAAGATTGGCTATATGGACATCGAAAAATATAAATATTAATAAATCG[C/T]
TTGTTTACGAGGAATGACTAGTCTCAGACCGTGTCGCATATAATGGCAATGCATCGTACGGTTCGTGTCGCCCTCACGTATGTGCTGCCTCCTCCTCTCC

Reverse complement sequence

GGAGAGGAGGAGGCAGCACATACGTGAGGGCGACACGAACCGTACGATGCATTGCCATTATATGCGACACGGTCTGAGACTAGTCATTCCTCGTAAACAA[G/A]
CGATTTATTAATATTTATATTTTTCGATGTCCATATAGCCAATCTTATGTGGAAGAATAGAGAATCACACATTAAATTCGAGAAAGTCAGTAAGAGGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.00% 31.50% 27.87% 8.55% NA
All Indica  2759 7.80% 33.90% 44.11% 14.24% NA
All Japonica  1512 69.10% 28.60% 2.05% 0.26% NA
Aus  269 48.00% 32.70% 18.22% 1.12% NA
Indica I  595 2.70% 40.50% 43.03% 13.78% NA
Indica II  465 3.00% 63.00% 18.92% 15.05% NA
Indica III  913 12.60% 18.00% 57.83% 11.61% NA
Indica Intermediate  786 8.90% 30.00% 43.89% 17.18% NA
Temperate Japonica  767 87.10% 10.70% 1.69% 0.52% NA
Tropical Japonica  504 46.80% 52.20% 0.99% 0.00% NA
Japonica Intermediate  241 58.50% 36.10% 5.39% 0.00% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 40.00% 34.40% 21.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718587094 C -> DEL N N silent_mutation Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953 N N N N
vg0718587094 C -> T LOC_Os07g31370.1 upstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953 N N N N
vg0718587094 C -> T LOC_Os07g31380.1 upstream_gene_variant ; 220.0bp to feature; MODIFIER silent_mutation Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953 N N N N
vg0718587094 C -> T LOC_Os07g31370-LOC_Os07g31380 intergenic_region ; MODIFIER silent_mutation Average:95.174; most accessible tissue: Zhenshan97 flower, score: 97.953 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0718587094 C T 0.0 -0.03 -0.03 -0.01 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718587094 NA 7.23E-08 Grain_weight Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0718587094 NA 2.77E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 7.49E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 2.25E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 1.17E-06 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 2.21E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 2.75E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 3.38E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 1.21E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 4.22E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 9.01E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 9.17E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718587094 NA 3.29E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251