\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712394149:

Variant ID: vg0712394149 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12394149
Reference Allele: AAlternative Allele: T,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGTACAACTGGCTGGATTGGTAGTGTCTGCTGAATCGGCTGCTGCTGCACTGGATCAACAATAGGTGGAGGTGGCAAAAACATGGCAGCAACCTGATC[A/T,C]
TGGGTCGGCGGATTCGCGATCTGCCCAGTAGGCTGTGGATGCTCCCTCATTAACAACCGAGGGTTCATCGGCTGGCCTAGCGCCATAGCTGATGTAGCGG

Reverse complement sequence

CCGCTACATCAGCTATGGCGCTAGGCCAGCCGATGAACCCTCGGTTGTTAATGAGGGAGCATCCACAGCCTACTGGGCAGATCGCGAATCCGCCGACCCA[T/A,G]
GATCAGGTTGCTGCCATGTTTTTGCCACCTCCACCTATTGTTGATCCAGTGCAGCAGCAGCCGATTCAGCAGACACTACCAATCCAGCCAGTTGTACAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 25.20% 0.40% 8.48% C: 0.04%
All Indica  2759 97.10% 1.00% 0.22% 1.70% NA
All Japonica  1512 6.30% 75.00% 0.60% 17.99% C: 0.07%
Aus  269 95.50% 0.00% 0.00% 4.46% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.00% 2.80% 0.00% 0.22% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 92.00% 1.70% 0.76% 5.60% NA
Temperate Japonica  767 2.10% 66.90% 1.17% 29.86% NA
Tropical Japonica  504 13.50% 85.50% 0.00% 0.99% NA
Japonica Intermediate  241 5.00% 78.80% 0.00% 15.77% C: 0.41%
VI/Aromatic  96 27.10% 1.00% 3.12% 67.71% C: 1.04%
Intermediate  90 60.00% 33.30% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712394149 A -> DEL LOC_Os07g22200.1 N frameshift_variant Average:67.306; most accessible tissue: Minghui63 flag leaf, score: 85.151 N N N N
vg0712394149 A -> C LOC_Os07g22200.1 missense_variant ; p.His273Gln; MODERATE nonsynonymous_codon ; H273Q Average:67.306; most accessible tissue: Minghui63 flag leaf, score: 85.151 probably damaging -2.213 TOLERATED 1.00
vg0712394149 A -> T LOC_Os07g22200.1 missense_variant ; p.His273Gln; MODERATE nonsynonymous_codon ; H273Q Average:67.306; most accessible tissue: Minghui63 flag leaf, score: 85.151 probably damaging -2.213 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0712394149 A C 0.0 0.0 0.0 0.0 0.0 0.0
vg0712394149 A T -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712394149 NA 9.73E-07 mr1236 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712394149 NA 7.63E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251