\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607958971:

Variant ID: vg0607958971 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7958971
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCCACGTGTACGCCACATAGACCAAAACCACCGTGGATTGGGTCGAGGGGGTTAATTCGTCCGGTTTGTATAGTTGGGGGTGAAGAATGTCCGGTTTT[A/G]
TGGTTCAGGGGGGTCATTCGGACGACCACCATAGTTCGGGGGGTAATTCGTACTTTTCCTCGTCCTAAATAGGTTCTAGTGGAAATTAATTTTGGACGAA

Reverse complement sequence

TTCGTCCAAAATTAATTTCCACTAGAACCTATTTAGGACGAGGAAAAGTACGAATTACCCCCCGAACTATGGTGGTCGTCCGAATGACCCCCCTGAACCA[T/C]
AAAACCGGACATTCTTCACCCCCAACTATACAAACCGGACGAATTAACCCCCTCGACCCAATCCACGGTGGTTTTGGTCTATGTGGCGTACACGTGGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 6.40% 0.21% 23.21% NA
All Indica  2759 98.40% 0.10% 0.00% 1.49% NA
All Japonica  1512 17.70% 19.40% 0.60% 62.30% NA
Aus  269 91.40% 0.00% 0.00% 8.55% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.40% 0.00% 0.00% 2.58% NA
Indica III  913 98.50% 0.00% 0.00% 1.53% NA
Indica Intermediate  786 98.00% 0.10% 0.00% 1.91% NA
Temperate Japonica  767 27.80% 34.00% 0.39% 37.81% NA
Tropical Japonica  504 2.40% 2.40% 0.99% 94.25% NA
Japonica Intermediate  241 17.80% 8.30% 0.41% 73.44% NA
VI/Aromatic  96 34.40% 0.00% 0.00% 65.62% NA
Intermediate  90 58.90% 8.90% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607958971 A -> G LOC_Os06g14260.1 upstream_gene_variant ; 2740.0bp to feature; MODIFIER silent_mutation Average:71.922; most accessible tissue: Callus, score: 81.124 N N N N
vg0607958971 A -> G LOC_Os06g14270.1 downstream_gene_variant ; 1818.0bp to feature; MODIFIER silent_mutation Average:71.922; most accessible tissue: Callus, score: 81.124 N N N N
vg0607958971 A -> G LOC_Os06g14280.1 downstream_gene_variant ; 4908.0bp to feature; MODIFIER silent_mutation Average:71.922; most accessible tissue: Callus, score: 81.124 N N N N
vg0607958971 A -> G LOC_Os06g14260-LOC_Os06g14270 intergenic_region ; MODIFIER silent_mutation Average:71.922; most accessible tissue: Callus, score: 81.124 N N N N
vg0607958971 A -> DEL N N silent_mutation Average:71.922; most accessible tissue: Callus, score: 81.124 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607958971 NA 4.33E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 1.77E-08 NA mr1019_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 1.83E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 1.02E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 6.50E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 3.00E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 4.86E-06 1.21E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 7.49E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 6.75E-24 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 5.53E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 3.27E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 4.71E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 2.53E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 1.02E-25 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 1.43E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 7.44E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 5.25E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 1.36E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 2.04E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 3.70E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 1.98E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 4.09E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 1.18E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 6.45E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 4.00E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971 NA 5.23E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251