Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607958971:

Variant ID: vg0607958971 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7958971
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGCCACGTGTACGCCACATAGACCAAAACCACCGTGGATTGGGTCGAGGGGGTTAATTCGTCCGGTTTGTATAGTTGGGGGTGAAGAATGTCCGGTTTT[A/G]
TGGTTCAGGGGGGTCATTCGGACGACCACCATAGTTCGGGGGGTAATTCGTACTTTTCCTCGTCCTAAATAGGTTCTAGTGGAAATTAATTTTGGACGAA

Reverse complement sequence

TTCGTCCAAAATTAATTTCCACTAGAACCTATTTAGGACGAGGAAAAGTACGAATTACCCCCCGAACTATGGTGGTCGTCCGAATGACCCCCCTGAACCA[T/C]
AAAACCGGACATTCTTCACCCCCAACTATACAAACCGGACGAATTAACCCCCTCGACCCAATCCACGGTGGTTTTGGTCTATGTGGCGTACACGTGGCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.20%	6.40%	0.21%	23.21%	NA
All Indica	2759	98.40%	0.10%	0.00%	1.49%	NA
All Japonica	1512	17.70%	19.40%	0.60%	62.30%	NA
Aus	269	91.40%	0.00%	0.00%	8.55%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.40%	0.00%	0.00%	2.58%	NA
Indica III	913	98.50%	0.00%	0.00%	1.53%	NA
Indica Intermediate	786	98.00%	0.10%	0.00%	1.91%	NA
Temperate Japonica	767	27.80%	34.00%	0.39%	37.81%	NA
Tropical Japonica	504	2.40%	2.40%	0.99%	94.25%	NA
Japonica Intermediate	241	17.80%	8.30%	0.41%	73.44%	NA
VI/Aromatic	96	34.40%	0.00%	0.00%	65.62%	NA
Intermediate	90	58.90%	8.90%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607958971	A -> G	LOC_Os06g14260.1	upstream_gene_variant ; 2740.0bp to feature; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 81.124	N	N	N	N
vg0607958971	A -> G	LOC_Os06g14270.1	downstream_gene_variant ; 1818.0bp to feature; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 81.124	N	N	N	N
vg0607958971	A -> G	LOC_Os06g14280.1	downstream_gene_variant ; 4908.0bp to feature; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 81.124	N	N	N	N
vg0607958971	A -> G	LOC_Os06g14260-LOC_Os06g14270	intergenic_region ; MODIFIER	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 81.124	N	N	N	N
vg0607958971	A -> DEL	N	N	silent_mutation	Average:71.922; most accessible tissue: Callus, score: 81.124	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607958971	NA	4.33E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	1.77E-08	NA	mr1019_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	1.83E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	1.02E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	6.50E-18	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	3.00E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	4.86E-06	1.21E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	7.49E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	6.75E-24	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	5.53E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	3.27E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	4.71E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	2.53E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	1.02E-25	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	1.43E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	7.44E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	5.25E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	1.36E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	2.04E-09	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	3.70E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	1.98E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	4.09E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	1.18E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	6.45E-31	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	4.00E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607958971	NA	5.23E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251