\
| Variant ID: vg0401900537 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 1900537 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 263. )
AGCCTCCTCCTCAGGAGAGAGAGGCGGTTCACTTCGTTTGCCCCGTGAAACATAGAAGCATTGCATCGCTGTCAACCACAGTAGTGCACGTGCTTTCCAT[A/C]
TCTTATAATTAGAACTATCAAAAGCATGTGGTTTCAGTGTTGCAGCAAAGCCAACTACCGAAAATGACCTATCAGGTTTTTGGATTGTTGGAAATTTGGT
ACCAAATTTCCAACAATCCAAAAACCTGATAGGTCATTTTCGGTAGTTGGCTTTGCTGCAACACTGAAACCACATGCTTTTGATAGTTCTAATTATAAGA[T/G]
ATGGAAAGCACGTGCACTACTGTGGTTGACAGCGATGCAATGCTTCTATGTTTCACGGGGCAAACGAAGTGAACCGCCTCTCTCTCCTGAGGAGGAGGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 9.30% | 14.58% | 7.41% | NA |
| All Indica | 2759 | 80.80% | 0.60% | 16.67% | 1.88% | NA |
| All Japonica | 1512 | 45.60% | 27.30% | 9.39% | 17.72% | NA |
| Aus | 269 | 64.30% | 0.70% | 25.65% | 9.29% | NA |
| Indica I | 595 | 95.80% | 0.30% | 2.69% | 1.18% | NA |
| Indica II | 465 | 69.50% | 1.10% | 25.38% | 4.09% | NA |
| Indica III | 913 | 74.00% | 0.10% | 25.30% | 0.55% | NA |
| Indica Intermediate | 786 | 84.10% | 1.10% | 12.09% | 2.67% | NA |
| Temperate Japonica | 767 | 17.20% | 44.60% | 6.78% | 31.42% | NA |
| Tropical Japonica | 504 | 79.00% | 3.60% | 15.08% | 2.38% | NA |
| Japonica Intermediate | 241 | 66.00% | 22.00% | 5.81% | 6.22% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 8.33% | 2.08% | NA |
| Intermediate | 90 | 75.60% | 10.00% | 11.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0401900537 | A -> C | LOC_Os04g04120.1 | missense_variant ; p.Ile186Arg; MODERATE | nonsynonymous_codon ; I186R | Average:26.518; most accessible tissue: Zhenshan97 root, score: 54.262 | probably damaging |
-2.13 |
TOLERATED | 1.00 |
| vg0401900537 | A -> DEL | LOC_Os04g04120.1 | N | frameshift_variant | Average:26.518; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0401900537 | NA | 9.38E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 3.09E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | 1.36E-08 | 6.80E-17 | mr1182 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 4.37E-09 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | 9.44E-08 | 8.32E-15 | mr1282 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 1.61E-08 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | 3.14E-08 | 4.46E-16 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 6.11E-08 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | 1.45E-06 | 1.07E-12 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 2.11E-07 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 4.39E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 6.28E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 5.80E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0401900537 | NA | 7.23E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |