\
| Variant ID: vg0327596758 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27596758 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAGTCCCGGTTTGTGTTACCAACCGGGACTAAAGATCATCTTTAGTCCCGGTTCGAATGCTGTCAGGACCTGTCAGGCCCCCCCGGGATCTTTAGTCCC[G/A]
GTTGGTAGCACCAACCGGGACTAAAGATCCCGGTGTCCCGGTTGGTAATACCAACCGGGACTAAAGATCTTGGTGATCTTTAAAGATCTTAACTTTAGTC
GACTAAAGTTAAGATCTTTAAAGATCACCAAGATCTTTAGTCCCGGTTGGTATTACCAACCGGGACACCGGGATCTTTAGTCCCGGTTGGTGCTACCAAC[C/T]
GGGACTAAAGATCCCGGGGGGGCCTGACAGGTCCTGACAGCATTCGAACCGGGACTAAAGATGATCTTTAGTCCCGGTTGGTAACACAAACCGGGACTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 0.70% | 8.57% | 18.92% | NA |
| All Indica | 2759 | 79.60% | 0.20% | 1.70% | 18.48% | NA |
| All Japonica | 1512 | 71.50% | 1.90% | 20.97% | 5.62% | NA |
| Aus | 269 | 2.20% | 0.00% | 0.74% | 97.03% | NA |
| Indica I | 595 | 51.40% | 0.00% | 3.03% | 45.55% | NA |
| Indica II | 465 | 89.20% | 0.20% | 1.94% | 8.60% | NA |
| Indica III | 913 | 90.10% | 0.20% | 0.44% | 9.20% | NA |
| Indica Intermediate | 786 | 83.10% | 0.30% | 2.04% | 14.63% | NA |
| Temperate Japonica | 767 | 65.40% | 3.30% | 25.95% | 5.35% | NA |
| Tropical Japonica | 504 | 83.90% | 0.00% | 11.51% | 4.56% | NA |
| Japonica Intermediate | 241 | 64.70% | 1.70% | 24.90% | 8.71% | NA |
| VI/Aromatic | 96 | 50.00% | 0.00% | 27.08% | 22.92% | NA |
| Intermediate | 90 | 66.70% | 1.10% | 14.44% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327596758 | G -> A | LOC_Os03g48450.1 | upstream_gene_variant ; 3926.0bp to feature; MODIFIER | silent_mutation | Average:7.433; most accessible tissue: Callus, score: 18.506 | N | N | N | N |
| vg0327596758 | G -> A | LOC_Os03g48457.1 | upstream_gene_variant ; 729.0bp to feature; MODIFIER | silent_mutation | Average:7.433; most accessible tissue: Callus, score: 18.506 | N | N | N | N |
| vg0327596758 | G -> A | LOC_Os03g48450.2 | upstream_gene_variant ; 3972.0bp to feature; MODIFIER | silent_mutation | Average:7.433; most accessible tissue: Callus, score: 18.506 | N | N | N | N |
| vg0327596758 | G -> A | LOC_Os03g48450.3 | upstream_gene_variant ; 3972.0bp to feature; MODIFIER | silent_mutation | Average:7.433; most accessible tissue: Callus, score: 18.506 | N | N | N | N |
| vg0327596758 | G -> A | LOC_Os03g48450.4 | upstream_gene_variant ; 3972.0bp to feature; MODIFIER | silent_mutation | Average:7.433; most accessible tissue: Callus, score: 18.506 | N | N | N | N |
| vg0327596758 | G -> A | LOC_Os03g48450-LOC_Os03g48457 | intergenic_region ; MODIFIER | silent_mutation | Average:7.433; most accessible tissue: Callus, score: 18.506 | N | N | N | N |
| vg0327596758 | G -> DEL | N | N | silent_mutation | Average:7.433; most accessible tissue: Callus, score: 18.506 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327596758 | 8.93E-06 | 4.41E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327596758 | 1.27E-06 | 5.92E-07 | mr1252 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327596758 | NA | 1.22E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327596758 | NA | 1.03E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327596758 | NA | 2.20E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327596758 | 2.26E-07 | 2.28E-08 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327596758 | NA | 5.05E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |