\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327596758:

Variant ID: vg0327596758 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27596758
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCCCGGTTTGTGTTACCAACCGGGACTAAAGATCATCTTTAGTCCCGGTTCGAATGCTGTCAGGACCTGTCAGGCCCCCCCGGGATCTTTAGTCCC[G/A]
GTTGGTAGCACCAACCGGGACTAAAGATCCCGGTGTCCCGGTTGGTAATACCAACCGGGACTAAAGATCTTGGTGATCTTTAAAGATCTTAACTTTAGTC

Reverse complement sequence

GACTAAAGTTAAGATCTTTAAAGATCACCAAGATCTTTAGTCCCGGTTGGTATTACCAACCGGGACACCGGGATCTTTAGTCCCGGTTGGTGCTACCAAC[C/T]
GGGACTAAAGATCCCGGGGGGGCCTGACAGGTCCTGACAGCATTCGAACCGGGACTAAAGATGATCTTTAGTCCCGGTTGGTAACACAAACCGGGACTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 0.70% 8.57% 18.92% NA
All Indica  2759 79.60% 0.20% 1.70% 18.48% NA
All Japonica  1512 71.50% 1.90% 20.97% 5.62% NA
Aus  269 2.20% 0.00% 0.74% 97.03% NA
Indica I  595 51.40% 0.00% 3.03% 45.55% NA
Indica II  465 89.20% 0.20% 1.94% 8.60% NA
Indica III  913 90.10% 0.20% 0.44% 9.20% NA
Indica Intermediate  786 83.10% 0.30% 2.04% 14.63% NA
Temperate Japonica  767 65.40% 3.30% 25.95% 5.35% NA
Tropical Japonica  504 83.90% 0.00% 11.51% 4.56% NA
Japonica Intermediate  241 64.70% 1.70% 24.90% 8.71% NA
VI/Aromatic  96 50.00% 0.00% 27.08% 22.92% NA
Intermediate  90 66.70% 1.10% 14.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327596758 G -> A LOC_Os03g48450.1 upstream_gene_variant ; 3926.0bp to feature; MODIFIER silent_mutation Average:7.433; most accessible tissue: Callus, score: 18.506 N N N N
vg0327596758 G -> A LOC_Os03g48457.1 upstream_gene_variant ; 729.0bp to feature; MODIFIER silent_mutation Average:7.433; most accessible tissue: Callus, score: 18.506 N N N N
vg0327596758 G -> A LOC_Os03g48450.2 upstream_gene_variant ; 3972.0bp to feature; MODIFIER silent_mutation Average:7.433; most accessible tissue: Callus, score: 18.506 N N N N
vg0327596758 G -> A LOC_Os03g48450.3 upstream_gene_variant ; 3972.0bp to feature; MODIFIER silent_mutation Average:7.433; most accessible tissue: Callus, score: 18.506 N N N N
vg0327596758 G -> A LOC_Os03g48450.4 upstream_gene_variant ; 3972.0bp to feature; MODIFIER silent_mutation Average:7.433; most accessible tissue: Callus, score: 18.506 N N N N
vg0327596758 G -> A LOC_Os03g48450-LOC_Os03g48457 intergenic_region ; MODIFIER silent_mutation Average:7.433; most accessible tissue: Callus, score: 18.506 N N N N
vg0327596758 G -> DEL N N silent_mutation Average:7.433; most accessible tissue: Callus, score: 18.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327596758 8.93E-06 4.41E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758 1.27E-06 5.92E-07 mr1252 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758 NA 1.22E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758 NA 1.03E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758 NA 2.20E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758 2.26E-07 2.28E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327596758 NA 5.05E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251