\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326424627:

Variant ID: vg0326424627 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26424627
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCCAAGATATAGCAAACTAGTACAAGATGTGATACATGCTAATACTACGAATCATGATAAGAGCTTTATATTGCTAACTTGCTATATTTTAGAATGGA[T/G]
GGAGTAACCATTTCTTGTCTCTCATCGCATCAGTGCCAAATCCTTATGGCATTGTGTAAAACAATGAATTGGTCTTGCGAAATCATCGTTTCCAGAACAT

Reverse complement sequence

ATGTTCTGGAAACGATGATTTCGCAAGACCAATTCATTGTTTTACACAATGCCATAAGGATTTGGCACTGATGCGATGAGAGACAAGAAATGGTTACTCC[A/C]
TCCATTCTAAAATATAGCAAGTTAGCAATATAAAGCTCTTATCATGATTCGTAGTATTAGCATGTATCACATCTTGTACTAGTTTGCTATATCTTGGAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 38.30% 0.93% 0.00% NA
All Indica  2759 51.90% 47.20% 0.94% 0.00% NA
All Japonica  1512 74.70% 24.70% 0.60% 0.00% NA
Aus  269 73.20% 24.20% 2.60% 0.00% NA
Indica I  595 33.10% 64.70% 2.18% 0.00% NA
Indica II  465 89.50% 9.90% 0.65% 0.00% NA
Indica III  913 39.00% 60.70% 0.33% 0.00% NA
Indica Intermediate  786 58.90% 40.20% 0.89% 0.00% NA
Temperate Japonica  767 95.20% 4.60% 0.26% 0.00% NA
Tropical Japonica  504 44.60% 54.20% 1.19% 0.00% NA
Japonica Intermediate  241 72.60% 27.00% 0.41% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326424627 T -> G LOC_Os03g46674.1 upstream_gene_variant ; 4898.0bp to feature; MODIFIER silent_mutation Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0326424627 T -> G LOC_Os03g46681.1 downstream_gene_variant ; 2421.0bp to feature; MODIFIER silent_mutation Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0326424627 T -> G LOC_Os03g46690.1 downstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0326424627 T -> G LOC_Os03g46681-LOC_Os03g46690 intergenic_region ; MODIFIER silent_mutation Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326424627 NA 2.95E-13 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326424627 NA 7.44E-13 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 6.51E-13 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 7.89E-15 mr1018 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 2.19E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 7.94E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 5.08E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 4.89E-17 mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 1.37E-12 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 9.43E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 3.42E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 1.74E-15 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 2.68E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 3.11E-13 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 1.54E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 3.86E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 1.26E-16 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 2.98E-16 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 9.91E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 1.67E-16 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 8.99E-17 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326424627 NA 1.60E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251