\
| Variant ID: vg0326424627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 26424627 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 119. )
GTTCCAAGATATAGCAAACTAGTACAAGATGTGATACATGCTAATACTACGAATCATGATAAGAGCTTTATATTGCTAACTTGCTATATTTTAGAATGGA[T/G]
GGAGTAACCATTTCTTGTCTCTCATCGCATCAGTGCCAAATCCTTATGGCATTGTGTAAAACAATGAATTGGTCTTGCGAAATCATCGTTTCCAGAACAT
ATGTTCTGGAAACGATGATTTCGCAAGACCAATTCATTGTTTTACACAATGCCATAAGGATTTGGCACTGATGCGATGAGAGACAAGAAATGGTTACTCC[A/C]
TCCATTCTAAAATATAGCAAGTTAGCAATATAAAGCTCTTATCATGATTCGTAGTATTAGCATGTATCACATCTTGTACTAGTTTGCTATATCTTGGAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.80% | 38.30% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 51.90% | 47.20% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 74.70% | 24.70% | 0.60% | 0.00% | NA |
| Aus | 269 | 73.20% | 24.20% | 2.60% | 0.00% | NA |
| Indica I | 595 | 33.10% | 64.70% | 2.18% | 0.00% | NA |
| Indica II | 465 | 89.50% | 9.90% | 0.65% | 0.00% | NA |
| Indica III | 913 | 39.00% | 60.70% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 58.90% | 40.20% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 4.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 44.60% | 54.20% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.60% | 27.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 24.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0326424627 | T -> G | LOC_Os03g46674.1 | upstream_gene_variant ; 4898.0bp to feature; MODIFIER | silent_mutation | Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0326424627 | T -> G | LOC_Os03g46681.1 | downstream_gene_variant ; 2421.0bp to feature; MODIFIER | silent_mutation | Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0326424627 | T -> G | LOC_Os03g46690.1 | downstream_gene_variant ; 195.0bp to feature; MODIFIER | silent_mutation | Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0326424627 | T -> G | LOC_Os03g46681-LOC_Os03g46690 | intergenic_region ; MODIFIER | silent_mutation | Average:32.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0326424627 | NA | 2.95E-13 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0326424627 | NA | 7.44E-13 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 6.51E-13 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 7.89E-15 | mr1018 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 2.19E-11 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 7.94E-08 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 5.08E-14 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 4.89E-17 | mr1132 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 1.37E-12 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 9.43E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 3.42E-14 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 1.74E-15 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 2.68E-09 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 3.11E-13 | mr1778 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 1.54E-09 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 3.86E-13 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 1.26E-16 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 2.98E-16 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 9.91E-08 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 1.67E-16 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 8.99E-17 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326424627 | NA | 1.60E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |