\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208287625:

Variant ID: vg0208287625 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8287625
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, T: 0.15, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TATAGTTTTGTTGCTATAAACTTTATAGTACATGAGAAATTATAAGTCAACCGTACCAAGTTTGACCATGCCTTATACTATTGGATAGATGGAGTAATAA[A/T]
TTTTAATCTTGCCGATCAGTGAGTGAAAAGTAATAGTTAGACAAACTTGGGTTTATTAGACTAATCTTTGTGTCATGCAAGCCAATACCGCTGGCACGTA

Reverse complement sequence

TACGTGCCAGCGGTATTGGCTTGCATGACACAAAGATTAGTCTAATAAACCCAAGTTTGTCTAACTATTACTTTTCACTCACTGATCGGCAAGATTAAAA[T/A]
TTATTACTCCATCTATCCAATAGTATAAGGCATGGTCAAACTTGGTACGGTTGACTTATAATTTCTCATGTACTATAAAGTTTATAGCAACAAAACTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.40% 0.04% 0.00% NA
All Indica  2759 48.60% 51.30% 0.07% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 61.70% 38.20% 0.17% 0.00% NA
Indica II  465 31.60% 68.40% 0.00% 0.00% NA
Indica III  913 48.10% 51.90% 0.00% 0.00% NA
Indica Intermediate  786 49.40% 50.50% 0.13% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208287625 A -> T LOC_Os02g14890.1 upstream_gene_variant ; 4847.0bp to feature; MODIFIER silent_mutation Average:35.22; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0208287625 A -> T LOC_Os02g14880.1 downstream_gene_variant ; 1677.0bp to feature; MODIFIER silent_mutation Average:35.22; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0208287625 A -> T LOC_Os02g14874-LOC_Os02g14880 intergenic_region ; MODIFIER silent_mutation Average:35.22; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208287625 NA 2.96E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 8.30E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 1.95E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 1.57E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 1.97E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 4.07E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 3.70E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 4.19E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 8.62E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 5.83E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 8.52E-07 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 3.88E-20 mr1909 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 7.55E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 2.66E-15 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 6.94E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208287625 NA 2.75E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251