| Variant ID: vg1223515381 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 23515381 |
| Reference Allele: CA | Alternative Allele: CAA,CAAA,C |
| Primary Allele: CA | Secondary Allele: CAA |
Inferred Ancestral Allele: Not determined.
ATTTTGATGTACTTTCCATCATAGAAGAATACTATGTTAGCCCCAATAGTTCTGCTTACAATTGATTTGAAGTTATATTCAGTTGAAGCCATCCATAAGA[CA/CAA,CAAA,C]
AAAAAAAAGTTGTCATTTCTAGTTACTGAATTTTGCGTTCTGTTTTTTGTTTTCTTGGTTCAGAAAGATGTACCCTGACCTGGCTGAGAAGATCACCACC
GGTGGTGATCTTCTCAGCCAGGTCAGGGTACATCTTTCTGAACCAAGAAAACAAAAAACAGAACGCAAAATTCAGTAACTAGAAATGACAACTTTTTTTT[TG/TTG,TTTG,G]
TCTTATGGATGGCTTCAACTGAATATAACTTCAAATCAATTGTAAGCAGAACTATTGGGGCTAACATAGTATTCTTCTATGATGGAAAGTACATCAAAAT
| Populations | Population Size | Frequency of CA(primary allele) | Frequency of CAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 44.50% | 0.19% | 0.00% | C: 0.59%; CAAA: 0.04% |
| All Indica | 2759 | 31.10% | 67.90% | 0.14% | 0.00% | C: 0.76%; CAAA: 0.04% |
| All Japonica | 1512 | 88.20% | 11.50% | 0.20% | 0.00% | C: 0.07% |
| Aus | 269 | 97.40% | 0.00% | 0.74% | 0.00% | C: 1.86% |
| Indica I | 595 | 39.00% | 59.00% | 0.17% | 0.00% | C: 1.85% |
| Indica II | 465 | 45.20% | 54.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 17.10% | 82.30% | 0.11% | 0.00% | C: 0.55% |
| Indica Intermediate | 786 | 33.20% | 65.90% | 0.13% | 0.00% | C: 0.64%; CAAA: 0.13% |
| Temperate Japonica | 767 | 93.70% | 5.90% | 0.26% | 0.00% | C: 0.13% |
| Tropical Japonica | 504 | 92.70% | 7.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.40% | 38.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 30.20% | 0.00% | 0.00% | C: 1.04%; CAAA: 1.04% |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223515381 | CA -> C | LOC_Os12g38310.1 | upstream_gene_variant ; 1270.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> C | LOC_Os12g38280.1 | downstream_gene_variant ; 4801.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> C | LOC_Os12g38290.1 | downstream_gene_variant ; 1905.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> C | LOC_Os12g38320.1 | downstream_gene_variant ; 4586.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> C | LOC_Os12g38300.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAAA | LOC_Os12g38310.1 | upstream_gene_variant ; 1269.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAAA | LOC_Os12g38280.1 | downstream_gene_variant ; 4802.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAAA | LOC_Os12g38290.1 | downstream_gene_variant ; 1906.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAAA | LOC_Os12g38320.1 | downstream_gene_variant ; 4585.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAAA | LOC_Os12g38300.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAA | LOC_Os12g38310.1 | upstream_gene_variant ; 1269.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAA | LOC_Os12g38280.1 | downstream_gene_variant ; 4802.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAA | LOC_Os12g38290.1 | downstream_gene_variant ; 1906.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAA | LOC_Os12g38320.1 | downstream_gene_variant ; 4585.0bp to feature; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |
| vg1223515381 | CA -> CAA | LOC_Os12g38300.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.146; most accessible tissue: Minghui63 root, score: 87.745 | N | N | N | N |