\
| Variant ID: vg1222349529 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 22349529 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCGAATTAATTCTGATCCCTGTCCCCGTCCCCGCTCACCCACGTGTAAGAATTCTCCCCCGCTCCCACCCCCGAAGGGGCGGGTCCCTGCCGGGTCCCT[G/A]
GCCCCAACGGGAAAATTGCACCCCTACGCCCGATCTTAGCGTGTGCTTTCCAAATGTGCTTGTTCTGTTGTTACTTTTCCAATTAGTAATTGTGACACGC
GCGTGTCACAATTACTAATTGGAAAAGTAACAACAGAACAAGCACATTTGGAAAGCACACGCTAAGATCGGGCGTAGGGGTGCAATTTTCCCGTTGGGGC[C/T]
AGGGACCCGGCAGGGACCCGCCCCTTCGGGGGTGGGAGCGGGGGAGAATTCTTACACGTGGGTGAGCGGGGACGGGGACAGGGATCAGAATTAATTCGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.80% | 7.30% | 0.00% | 0.91% | NA |
| All Indica | 2759 | 94.50% | 4.10% | 0.00% | 1.41% | NA |
| All Japonica | 1512 | 96.70% | 3.10% | 0.00% | 0.20% | NA |
| Aus | 269 | 34.20% | 65.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.60% | 3.00% | 0.00% | 5.38% | NA |
| Indica III | 913 | 94.30% | 5.60% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 92.20% | 6.10% | 0.00% | 1.65% | NA |
| Temperate Japonica | 767 | 93.90% | 5.70% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1222349529 | G -> DEL | N | N | silent_mutation | Average:58.115; most accessible tissue: Callus, score: 87.921 | N | N | N | N |
| vg1222349529 | G -> A | LOC_Os12g36510.1 | downstream_gene_variant ; 542.0bp to feature; MODIFIER | silent_mutation | Average:58.115; most accessible tissue: Callus, score: 87.921 | N | N | N | N |
| vg1222349529 | G -> A | LOC_Os12g36500-LOC_Os12g36510 | intergenic_region ; MODIFIER | silent_mutation | Average:58.115; most accessible tissue: Callus, score: 87.921 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1222349529 | NA | 7.80E-09 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349529 | NA | 5.80E-08 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349529 | 5.84E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349529 | 5.68E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349529 | 4.00E-08 | NA | mr1529_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349529 | NA | 2.31E-08 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349529 | NA | 3.34E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1222349529 | NA | 1.95E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |