\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222349529:

Variant ID: vg1222349529 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22349529
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGAATTAATTCTGATCCCTGTCCCCGTCCCCGCTCACCCACGTGTAAGAATTCTCCCCCGCTCCCACCCCCGAAGGGGCGGGTCCCTGCCGGGTCCCT[G/A]
GCCCCAACGGGAAAATTGCACCCCTACGCCCGATCTTAGCGTGTGCTTTCCAAATGTGCTTGTTCTGTTGTTACTTTTCCAATTAGTAATTGTGACACGC

Reverse complement sequence

GCGTGTCACAATTACTAATTGGAAAAGTAACAACAGAACAAGCACATTTGGAAAGCACACGCTAAGATCGGGCGTAGGGGTGCAATTTTCCCGTTGGGGC[C/T]
AGGGACCCGGCAGGGACCCGCCCCTTCGGGGGTGGGAGCGGGGGAGAATTCTTACACGTGGGTGAGCGGGGACGGGGACAGGGATCAGAATTAATTCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 7.30% 0.00% 0.91% NA
All Indica  2759 94.50% 4.10% 0.00% 1.41% NA
All Japonica  1512 96.70% 3.10% 0.00% 0.20% NA
Aus  269 34.20% 65.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 91.60% 3.00% 0.00% 5.38% NA
Indica III  913 94.30% 5.60% 0.00% 0.11% NA
Indica Intermediate  786 92.20% 6.10% 0.00% 1.65% NA
Temperate Japonica  767 93.90% 5.70% 0.00% 0.39% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222349529 G -> DEL N N silent_mutation Average:58.115; most accessible tissue: Callus, score: 87.921 N N N N
vg1222349529 G -> A LOC_Os12g36510.1 downstream_gene_variant ; 542.0bp to feature; MODIFIER silent_mutation Average:58.115; most accessible tissue: Callus, score: 87.921 N N N N
vg1222349529 G -> A LOC_Os12g36500-LOC_Os12g36510 intergenic_region ; MODIFIER silent_mutation Average:58.115; most accessible tissue: Callus, score: 87.921 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222349529 NA 7.80E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349529 NA 5.80E-08 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349529 5.84E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349529 5.68E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349529 4.00E-08 NA mr1529_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349529 NA 2.31E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349529 NA 3.34E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349529 NA 1.95E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251