Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215802194:

Variant ID: vg1215802194 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15802194
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCAAGGTCGAAGTTGAGTTGGTCGAAGGCGCGTACGAGGACCTCGAGTTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCAC[G/A]
CCATTATACTATGGCGCAAGCGATACATCATCCTCCCAGGGCGACAAGCGGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGCTCC

Reverse complement sequence

GGAGCCTGAGGAGGAGATGGCGGAGCCGGAGGAGATGGTGCACGAGACGCCGCTTGTCGCCCTGGGAGGATGATGTATCGCTTGCGCCATAGTATAATGG[C/T]
GTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCAGGGTAATCCAACTCGAGGTCCTCGTACGCGCCTTCGACCAACTCAACTTCGACCTTGGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	23.00%	0.11%	0.00%	NA
All Indica	2759	61.90%	37.90%	0.14%	0.00%	NA
All Japonica	1512	98.30%	1.60%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	71.60%	28.10%	0.34%	0.00%	NA
Indica II	465	93.30%	6.70%	0.00%	0.00%	NA
Indica III	913	37.10%	62.80%	0.11%	0.00%	NA
Indica Intermediate	786	64.90%	35.00%	0.13%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215802194	G -> A	LOC_Os12g26980.1	upstream_gene_variant ; 2592.0bp to feature; MODIFIER	silent_mutation	Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg1215802194	G -> A	LOC_Os12g26970.1	downstream_gene_variant ; 4001.0bp to feature; MODIFIER	silent_mutation	Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg1215802194	G -> A	LOC_Os12g26970-LOC_Os12g26980	intergenic_region ; MODIFIER	silent_mutation	Average:31.99; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215802194	NA	8.76E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	NA	9.18E-06	mr1282	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	5.08E-06	5.08E-06	mr1282_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	NA	7.13E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	NA	1.30E-08	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	NA	4.37E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	NA	5.69E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	NA	5.70E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215802194	NA	4.38E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251