\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215671844:

Variant ID: vg1215671844 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15671844
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAGTATGCTTGCTGATAAAGGCATTCAGCCAGGCCACTCGCATTGTGAATGTAAGTCCATTTACGCATAGCTTTAATTGTTCCCCTTCATATTTTACT[G/A]
AAAACACCGGTAAATTCTTATTGCAGAGAATCCATCTCAGGAATGAGGCAAAGACCATGACACTTGAGAAATTAGTTCCCCATCTTGGAACTCTTGAAGC

Reverse complement sequence

GCTTCAAGAGTTCCAAGATGGGGAACTAATTTCTCAAGTGTCATGGTCTTTGCCTCATTCCTGAGATGGATTCTCTGCAATAAGAATTTACCGGTGTTTT[C/T]
AGTAAAATATGAAGGGGAACAATTAAAGCTATGCGTAAATGGACTTACATTCACAATGCGAGTGGCCTGGCTGAATGCCTTTATCAGCAAGCATACTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 31.80% 4.93% 5.23% NA
All Indica  2759 43.40% 42.40% 5.87% 8.37% NA
All Japonica  1512 90.10% 9.50% 0.07% 0.33% NA
Aus  269 19.00% 52.00% 26.02% 2.97% NA
Indica I  595 23.70% 75.80% 0.34% 0.17% NA
Indica II  465 37.40% 19.80% 13.55% 29.25% NA
Indica III  913 61.70% 31.00% 5.15% 2.19% NA
Indica Intermediate  786 40.60% 43.60% 6.36% 9.41% NA
Temperate Japonica  767 96.70% 2.70% 0.13% 0.39% NA
Tropical Japonica  504 80.00% 20.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 8.70% 0.00% 0.83% NA
VI/Aromatic  96 75.00% 24.00% 0.00% 1.04% NA
Intermediate  90 68.90% 28.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215671844 G -> DEL N N silent_mutation Average:29.285; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1215671844 G -> A LOC_Os12g26750.1 downstream_gene_variant ; 2153.0bp to feature; MODIFIER silent_mutation Average:29.285; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1215671844 G -> A LOC_Os12g26740.1 intron_variant ; MODIFIER silent_mutation Average:29.285; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215671844 2.28E-08 2.03E-15 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 3.76E-07 1.94E-15 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 8.81E-08 7.15E-15 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 1.82E-07 1.37E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 1.51E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 3.71E-09 3.30E-17 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 3.68E-06 2.21E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 1.09E-06 6.02E-15 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 8.78E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 4.30E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 6.57E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 2.01E-08 2.46E-17 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 3.39E-08 5.01E-17 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 3.09E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 7.72E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 3.35E-06 7.09E-13 mr1790 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 2.24E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 5.46E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 5.27E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 1.04E-06 5.90E-13 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 1.34E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 7.87E-08 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 2.21E-10 1.63E-17 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 4.89E-07 7.99E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 1.31E-11 8.27E-22 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 8.78E-09 7.86E-19 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 NA 5.10E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 2.27E-12 9.21E-22 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 3.91E-07 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215671844 2.09E-12 5.59E-22 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251