Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213095879:

Variant ID: vg1213095879 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13095879
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCCGCCAAGATACTGAAATCCAGCCAGCTCCAGCTCCTTCAGAATCCCGTCCTCTCCAATCACATAAACCTGAACAATTAAAATGTTAAACATGCACA[C/T]
ATTATTTGCCAAAATCGCTGAACATGAACAGTATAAATGGTAACGTTGTGCACGTATCTTCGTACCAAAACATGTTAACTTCTGAAGATGGTGATATAAA

Reverse complement sequence

TTTATATCACCATCTTCAGAAGTTAACATGTTTTGGTACGAAGATACGTGCACAACGTTACCATTTATACTGTTCATGTTCAGCGATTTTGGCAAATAAT[G/A]
TGTGCATGTTTAACATTTTAATTGTTCAGGTTTATGTGATTGGAGAGGACGGGATTCTGAAGGAGCTGGAGCTGGCTGGATTTCAGTATCTTGGCGGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 16.10% 0.40% 12.12% NA
All Indica  2759 76.90% 3.30% 0.65% 19.21% NA
All Japonica  1512 54.20% 43.10% 0.07% 2.65% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 0.70% 0.00% 1.18% NA
Indica II  465 53.10% 3.40% 1.08% 42.37% NA
Indica III  913 77.40% 3.10% 0.55% 18.95% NA
Indica Intermediate  786 74.20% 5.30% 1.02% 19.47% NA
Temperate Japonica  767 17.70% 77.40% 0.13% 4.69% NA
Tropical Japonica  504 99.00% 0.60% 0.00% 0.40% NA
Japonica Intermediate  241 76.30% 22.80% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 21.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213095879 C -> DEL N N silent_mutation Average:62.187; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg1213095879 C -> T LOC_Os12g23160.1 upstream_gene_variant ; 2969.0bp to feature; MODIFIER silent_mutation Average:62.187; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg1213095879 C -> T LOC_Os12g23170.1 upstream_gene_variant ; 3769.0bp to feature; MODIFIER silent_mutation Average:62.187; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg1213095879 C -> T LOC_Os12g23150.1 intron_variant ; MODIFIER silent_mutation Average:62.187; most accessible tissue: Minghui63 flower, score: 76.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213095879 NA 4.75E-15 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 7.22E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 4.33E-14 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 6.35E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 3.09E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 3.72E-14 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 3.63E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 4.70E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 2.32E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 6.39E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 3.17E-13 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 7.17E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 8.09E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 3.13E-16 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 2.85E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 2.03E-13 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 4.69E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 2.18E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 8.40E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 5.95E-15 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 1.65E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 1.78E-13 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095879 NA 1.03E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251