Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213095729:

Variant ID: vg1213095729 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 13095729
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTAGTTACATCTTTGTCATGCTCCATGTAAAATCCAGGCTTCAGTTCTATCTTCTTGTCTCCATCAGACTGCAAGATGATTGTTATGTGTGTTAGTCT[G/A]
TCCCAGGAATGCAGCACTGAACATGGGTTCAGAAATTTTATTACTTACTGGCCCGCCAAGATACTGAAATCCAGCCAGCTCCAGCTCCTTCAGAATCCCG

Reverse complement sequence

CGGGATTCTGAAGGAGCTGGAGCTGGCTGGATTTCAGTATCTTGGCGGGCCAGTAAGTAATAAAATTTCTGAACCCATGTTCAGTGCTGCATTCCTGGGA[C/T]
AGACTAACACACATAACAATCATCTTGCAGTCTGATGGAGACAAGAAGATAGAACTGAAGCCTGGATTTTACATGGAGCATGACAAAGATGTAACTACGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	22.00%	0.47%	12.15%	NA
All Indica	2759	43.70%	36.20%	0.76%	19.25%	NA
All Japonica	1512	96.40%	1.00%	0.00%	2.65%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	59.70%	38.80%	0.00%	1.51%	NA
Indica II	465	32.50%	23.00%	0.86%	43.66%	NA
Indica III	913	34.90%	45.80%	0.88%	18.40%	NA
Indica Intermediate	786	48.60%	31.00%	1.15%	19.21%	NA
Temperate Japonica	767	94.10%	1.20%	0.00%	4.69%	NA
Tropical Japonica	504	98.40%	1.20%	0.00%	0.40%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	83.30%	12.20%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1213095729	G -> DEL	N	N	silent_mutation	Average:66.136; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg1213095729	G -> A	LOC_Os12g23160.1	upstream_gene_variant ; 3119.0bp to feature; MODIFIER	silent_mutation	Average:66.136; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg1213095729	G -> A	LOC_Os12g23170.1	upstream_gene_variant ; 3919.0bp to feature; MODIFIER	silent_mutation	Average:66.136; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg1213095729	G -> A	LOC_Os12g23150.1	intron_variant ; MODIFIER	silent_mutation	Average:66.136; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1213095729	NA	5.38E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095729	NA	8.04E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213095729	NA	1.17E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251