\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207803628:

Variant ID: vg1207803628 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7803628
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.29, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCCTTCAGGTAGTACCTGCAAGTCCAAACCATTAACTAACAAGGACATAGGCCTGGTTTAGTTGGCAATTTTTTTTTGTCACATCGGATATACGGACA[T/C]
ACATTTGAAGTATTAAAACATTGTCTAATAACAAAACAAATTACAGATTATGCCTGAAAACTGCGAGACGAATTTATTTATTAAGCCTAATTAATCCGTC

Reverse complement sequence

GACGGATTAATTAGGCTTAATAAATAAATTCGTCTCGCAGTTTTCAGGCATAATCTGTAATTTGTTTTGTTATTAGACAATGTTTTAATACTTCAAATGT[A/G]
TGTCCGTATATCCGATGTGACAAAAAAAAATTGCCAACTAAACCAGGCCTATGTCCTTGTTAGTTAATGGTTTGGACTTGCAGGTACTACCTGAAGGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 17.30% 4.13% 10.58% NA
All Indica  2759 80.20% 2.20% 3.70% 13.85% NA
All Japonica  1512 51.90% 46.40% 0.20% 1.52% NA
Aus  269 39.40% 2.20% 28.62% 29.74% NA
Indica I  595 83.40% 1.50% 6.72% 8.40% NA
Indica II  465 73.50% 4.30% 3.23% 18.92% NA
Indica III  913 81.30% 0.90% 1.31% 16.54% NA
Indica Intermediate  786 80.70% 3.10% 4.45% 11.83% NA
Temperate Japonica  767 33.50% 64.00% 0.13% 2.35% NA
Tropical Japonica  504 71.80% 27.40% 0.00% 0.79% NA
Japonica Intermediate  241 68.50% 30.30% 0.83% 0.41% NA
VI/Aromatic  96 58.30% 21.90% 10.42% 9.38% NA
Intermediate  90 60.00% 30.00% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207803628 T -> C LOC_Os12g13790.1 downstream_gene_variant ; 4068.0bp to feature; MODIFIER silent_mutation Average:60.553; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N
vg1207803628 T -> C LOC_Os12g13810.1 downstream_gene_variant ; 2886.0bp to feature; MODIFIER silent_mutation Average:60.553; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N
vg1207803628 T -> C LOC_Os12g13800.1 intron_variant ; MODIFIER silent_mutation Average:60.553; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N
vg1207803628 T -> DEL N N silent_mutation Average:60.553; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207803628 NA 1.05E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207803628 NA 5.55E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207803628 2.08E-16 6.68E-20 mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 9.71E-10 1.49E-18 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 4.52E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.08E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 2.31E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 5.13E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.47E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 2.65E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 4.63E-28 1.57E-31 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 8.37E-19 4.00E-32 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.86E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.27E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 5.91E-18 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 4.63E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.66E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 3.09E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 7.25E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 3.39E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.14E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.83E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207803628 NA 1.40E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251