Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204725380:

Variant ID: vg1204725380 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4725380
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCAACCAACCGTATAGGCGAGGACACCAGTCGGCGGCAACGAGGCGGTCGGTCAGTGAAGACGGAGACTCCCAACAGCGGTGGTGTGACCAACCAACC[A/G]
TGTAGGCGAGGACACCAGTCGGCGGCGACGAGGCGGCTAGTCGGTGAAGACGCAGACGCCCAACAACGGTGGCGTGACCATCAAACCGTGTAGGCGAGGA

Reverse complement sequence

TCCTCGCCTACACGGTTTGATGGTCACGCCACCGTTGTTGGGCGTCTGCGTCTTCACCGACTAGCCGCCTCGTCGCCGCCGACTGGTGTCCTCGCCTACA[T/C]
GGTTGGTTGGTCACACCACCGCTGTTGGGAGTCTCCGTCTTCACTGACCGACCGCCTCGTTGCCGCCGACTGGTGTCCTCGCCTATACGGTTGGTTGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 2.00% 0.15% 4.13% NA
All Indica  2759 98.90% 0.90% 0.00% 0.11% NA
All Japonica  1512 90.30% 0.10% 0.33% 9.33% NA
Aus  269 59.10% 21.60% 0.74% 18.59% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.00% 0.00% 0.38% NA
Temperate Japonica  767 97.30% 0.00% 0.26% 2.48% NA
Tropical Japonica  504 92.50% 0.00% 0.40% 7.14% NA
Japonica Intermediate  241 63.50% 0.40% 0.41% 35.68% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204725380 A -> DEL N N silent_mutation Average:76.683; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N
vg1204725380 A -> G LOC_Os12g09030.1 upstream_gene_variant ; 3569.0bp to feature; MODIFIER silent_mutation Average:76.683; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N
vg1204725380 A -> G LOC_Os12g09050.1 upstream_gene_variant ; 4089.0bp to feature; MODIFIER silent_mutation Average:76.683; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N
vg1204725380 A -> G LOC_Os12g09030-LOC_Os12g09050 intergenic_region ; MODIFIER silent_mutation Average:76.683; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1204725380 A G 0.0 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204725380 NA 3.19E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 9.39E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 3.52E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 3.35E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 4.57E-08 5.65E-11 mr1679 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 6.26E-08 3.04E-10 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 1.02E-07 NA mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 5.89E-11 9.06E-17 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 1.65E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 3.74E-08 5.36E-10 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 8.02E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 5.75E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 3.83E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 2.42E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 2.32E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 4.22E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 8.13E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 3.89E-06 1.08E-09 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204725380 NA 1.00E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251