Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202743447:

Variant ID: vg1202743447 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2743447
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGAAGGAGCGCCCATAATCAAAGCCCCGGAGATGTAGGCTTCGTTTGAACTTCGTTAACAAATATTGTGTGTTCATGTGCCGTCATCTGGCATGTCTT[A/G]
GGTGATCAATGACTGAAGTGATCGAGAGAGTTAGCTGTCGTTTCGCTATATCAACTAACTTTTGTAACACCTTCTAGTAGAACTATATGTATTCTATATG

Reverse complement sequence

CATATAGAATACATATAGTTCTACTAGAAGGTGTTACAAAAGTTAGTTGATATAGCGAAACGACAGCTAACTCTCTCGATCACTTCAGTCATTGATCACC[T/C]
AAGACATGCCAGATGACGGCACATGAACACACAATATTTGTTAACGAAGTTCAAACGAAGCCTACATCTCCGGGGCTTTGATTATGGGCGCTCCTTCCCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	6.40%	0.40%	2.64%	NA
All Indica	2759	92.30%	6.80%	0.11%	0.80%	NA
All Japonica	1512	98.60%	1.20%	0.07%	0.13%	NA
Aus	269	23.00%	34.20%	5.20%	37.55%	NA
Indica I	595	94.10%	5.70%	0.00%	0.17%	NA
Indica II	465	98.30%	1.10%	0.22%	0.43%	NA
Indica III	913	88.80%	10.60%	0.11%	0.44%	NA
Indica Intermediate	786	91.30%	6.60%	0.13%	1.91%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.00%	0.20%	NA
Japonica Intermediate	241	94.20%	5.00%	0.41%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202743447	A -> DEL	N	N	silent_mutation	Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661	N	N	N	N
vg1202743447	A -> G	LOC_Os12g05940.1	downstream_gene_variant ; 3336.0bp to feature; MODIFIER	silent_mutation	Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661	N	N	N	N
vg1202743447	A -> G	LOC_Os12g05950.1	downstream_gene_variant ; 2023.0bp to feature; MODIFIER	silent_mutation	Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661	N	N	N	N
vg1202743447	A -> G	LOC_Os12g05960.1	downstream_gene_variant ; 857.0bp to feature; MODIFIER	silent_mutation	Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661	N	N	N	N
vg1202743447	A -> G	LOC_Os12g05970.1	downstream_gene_variant ; 4128.0bp to feature; MODIFIER	silent_mutation	Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661	N	N	N	N
vg1202743447	A -> G	LOC_Os12g05950-LOC_Os12g05960	intergenic_region ; MODIFIER	silent_mutation	Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202743447	NA	2.38E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	6.25E-07	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	3.70E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	6.94E-06	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	2.09E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	3.68E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	2.40E-06	mr1474	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	2.40E-06	mr1475	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	8.22E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	3.31E-09	1.64E-44	mr1549	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	6.47E-07	2.23E-43	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	1.39E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	5.51E-06	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	2.92E-07	2.86E-44	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	1.39E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	5.87E-06	NA	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	1.34E-06	3.57E-38	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	1.09E-44	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	1.62E-07	6.64E-36	mr1757_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447	NA	2.03E-07	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251