\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202743447:

Variant ID: vg1202743447 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2743447
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGAAGGAGCGCCCATAATCAAAGCCCCGGAGATGTAGGCTTCGTTTGAACTTCGTTAACAAATATTGTGTGTTCATGTGCCGTCATCTGGCATGTCTT[A/G]
GGTGATCAATGACTGAAGTGATCGAGAGAGTTAGCTGTCGTTTCGCTATATCAACTAACTTTTGTAACACCTTCTAGTAGAACTATATGTATTCTATATG

Reverse complement sequence

CATATAGAATACATATAGTTCTACTAGAAGGTGTTACAAAAGTTAGTTGATATAGCGAAACGACAGCTAACTCTCTCGATCACTTCAGTCATTGATCACC[T/C]
AAGACATGCCAGATGACGGCACATGAACACACAATATTTGTTAACGAAGTTCAAACGAAGCCTACATCTCCGGGGCTTTGATTATGGGCGCTCCTTCCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 6.40% 0.40% 2.64% NA
All Indica  2759 92.30% 6.80% 0.11% 0.80% NA
All Japonica  1512 98.60% 1.20% 0.07% 0.13% NA
Aus  269 23.00% 34.20% 5.20% 37.55% NA
Indica I  595 94.10% 5.70% 0.00% 0.17% NA
Indica II  465 98.30% 1.10% 0.22% 0.43% NA
Indica III  913 88.80% 10.60% 0.11% 0.44% NA
Indica Intermediate  786 91.30% 6.60% 0.13% 1.91% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.00% 0.20% NA
Japonica Intermediate  241 94.20% 5.00% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202743447 A -> DEL N N silent_mutation Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661 N N N N
vg1202743447 A -> G LOC_Os12g05940.1 downstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661 N N N N
vg1202743447 A -> G LOC_Os12g05950.1 downstream_gene_variant ; 2023.0bp to feature; MODIFIER silent_mutation Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661 N N N N
vg1202743447 A -> G LOC_Os12g05960.1 downstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661 N N N N
vg1202743447 A -> G LOC_Os12g05970.1 downstream_gene_variant ; 4128.0bp to feature; MODIFIER silent_mutation Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661 N N N N
vg1202743447 A -> G LOC_Os12g05950-LOC_Os12g05960 intergenic_region ; MODIFIER silent_mutation Average:56.206; most accessible tissue: Zhenshan97 root, score: 75.661 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202743447 NA 2.38E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 6.25E-07 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 3.70E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 6.94E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 2.09E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 3.68E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 2.40E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 2.40E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 8.22E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 3.31E-09 1.64E-44 mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 6.47E-07 2.23E-43 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 1.39E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 5.51E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 2.92E-07 2.86E-44 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 1.39E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 5.87E-06 NA mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 1.34E-06 3.57E-38 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 1.09E-44 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 1.62E-07 6.64E-36 mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202743447 NA 2.03E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251