Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127358883:

Variant ID: vg1127358883 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27358883
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTCCTTACCAACAAGGCAGGTGAAGACCAAGTACTCTGGCTAGGTTGAATGACCCCTGATGACAACATTTCAGCAACTTGTCTTTCAATCTCATCCTT[G/A]
AGCTCCGGATTGTATCTATAAGGCCTCAGGTTAACTGGTTGGGCTCCCTCTATTAAAGGAATTCTATGATCACAATATCTGGTAGGGGGCAGGCCCCTAG

Reverse complement sequence

CTAGGGGCCTGCCCCCTACCAGATATTGTGATCATAGAATTCCTTTAATAGAGGGAGCCCAACCAGTTAACCTGAGGCCTTATAGATACAATCCGGAGCT[C/T]
AAGGATGAGATTGAAAGACAAGTTGCTGAAATGTTGTCATCAGGGGTCATTCAACCTAGCCAGAGTACTTGGTCTTCACCTGCCTTGTTGGTAAGGAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	23.30%	0.74%	24.29%	NA
All Indica	2759	52.30%	32.20%	0.94%	14.50%	NA
All Japonica	1512	47.80%	11.70%	0.33%	40.15%	NA
Aus	269	61.30%	2.20%	0.37%	36.06%	NA
Indica I	595	78.20%	3.70%	0.84%	17.31%	NA
Indica II	465	24.50%	72.00%	0.65%	2.80%	NA
Indica III	913	53.20%	26.80%	1.10%	18.84%	NA
Indica Intermediate	786	48.20%	36.50%	1.02%	14.25%	NA
Temperate Japonica	767	66.60%	5.50%	0.26%	27.64%	NA
Tropical Japonica	504	22.40%	16.30%	0.40%	60.91%	NA
Japonica Intermediate	241	41.10%	22.00%	0.41%	36.51%	NA
VI/Aromatic	96	70.80%	4.20%	1.04%	23.96%	NA
Intermediate	90	47.80%	26.70%	2.22%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127358883	G -> A	LOC_Os11g45200.1	synonymous_variant ; p.Leu521Leu; LOW	synonymous_codon	Average:41.818; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg1127358883	G -> DEL	LOC_Os11g45200.1	N	frameshift_variant	Average:41.818; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127358883	NA	3.11E-06	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	4.26E-06	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	8.85E-06	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.24E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	6.14E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.52E-07	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.37E-06	mr1742	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	4.38E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	8.37E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	9.58E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	3.00E-06	NA	mr1042_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	4.45E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	2.44E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.86E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	5.24E-10	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	3.02E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	3.17E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	5.79E-09	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	2.63E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.26E-07	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.31E-07	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	2.93E-07	NA	mr1871_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.09E-08	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	4.77E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	2.04E-07	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	6.66E-06	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	1.57E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	8.30E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127358883	NA	2.25E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251